ZEB1 Rabbit Polyclonal Antibody

ZEB1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ZEB1 Polyclonal Antibody

    ABP60963-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human ZEB1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ZEB1 from Human, Mouse, Rat. This ZEB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZEB1 protein

    ZEB1 Polyclonal Antibody

    ABP60963-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human ZEB1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ZEB1 from Human, Mouse, Rat. This ZEB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZEB1 protein

    ZEB1 Polyclonal Antibody

    ES11957-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ZEB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ZEB1 Polyclonal Antibody

    ES11957-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ZEB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ZEB1 Rabbit pAb

    A5600-100ul 100 ul
    EUR 308

    ZEB1 Rabbit pAb

    A5600-200ul 200 ul
    EUR 459

    ZEB1 Rabbit pAb

    A5600-20ul 20 ul
    EUR 183

    ZEB1 Rabbit pAb

    A5600-50ul 50 ul
    EUR 223

    ZEB1 Rabbit pAb

    A16981-100ul 100 ul
    EUR 308

    ZEB1 Rabbit pAb

    A16981-200ul 200 ul
    EUR 459

    ZEB1 Rabbit pAb

    A16981-20ul 20 ul
    EUR 183

    ZEB1 Rabbit pAb

    A16981-50ul 50 ul
    EUR 223

    ZEB1 Rabbit pAb

    A1500-100ul 100 ul
    EUR 308

    ZEB1 Rabbit pAb

    A1500-200ul 200 ul
    EUR 459

    ZEB1 Rabbit pAb

    A1500-20ul 20 ul
    EUR 183

    ZEB1 Rabbit pAb

    A1500-50ul 50 ul
    EUR 223

    Polyclonal ZEB1 / AREB6 Antibody

    APR03087G 0.05ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZEB1 / AREB6 . This antibody is tested and proven to work in the following applications:

    ZEB1 Antibody

    25144-100ul 100ul
    EUR 390

    ZEB1 antibody

    70R-21378 50 ul
    EUR 435
    Description: Rabbit polyclonal ZEB1 antibody

    ZEB1 antibody

    38675-100ul 100ul
    EUR 252

    ZEB1 Antibody

    DF7414 200ul
    EUR 304
    Description: ZEB1 Antibody detects endogenous levels of total ZEB1.

    ZEB1 Antibody

    1-CSB-PA026424GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    ZEB1 Antibody

    1-CSB-PA026424LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

    ZEB1 Antibody

    AF7564 200ul
    EUR 376
    Description: ZEB1 Antibody detects endogenous levels of ZEB1.

    ZEB1 Antibody

    ABD7414 100 ug
    EUR 438

    Polyclonal Goat Anti-AREB6 / ZEB1 Antibody

    APG00035G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AREB6 / ZEB1 . This antibody is tested and proven to work in the following applications:

    ZEB1 (Phospho-Ser887) Polyclonal Conjugated Antibody

    C12929 100ul
    EUR 397

    anti- ZEB1 antibody

    FNab09620 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:5000
    • IP: 1:200-1:2000;IHC: 1:500-1:5000
    • Immunogen: zinc finger E-box binding homeobox 1
    • Uniprot ID: P37275
    • Gene ID: 6935
    • Research Area: Metabolism
    Description: Antibody raised against ZEB1

    Anti-ZEB1 antibody

    PAab09620 100 ug
    EUR 386

    Anti-ZEB1 antibody

    STJ26150 100 µl
    EUR 277
    Description: This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.

    Anti-ZEB1 antibody

    STJ28276 100 µl
    EUR 277
    Description: This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.

    Anti-ZEB1 antibody

    STJ119284 100 µl
    EUR 277

    Anti-ZEB1 antibody

    STJ193115 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ZEB1

    Zeb1/ Rat Zeb1 ELISA Kit

    ELI-40691r 96 Tests
    EUR 886

    ZEB1 siRNA

    20-abx940363
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ZEB1 siRNA

    20-abx940364
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ZEB1 (Phospho-Ser887) Antibody

    12929-100ul 100ul
    EUR 252

    ZEB1 (Phospho-Ser887) Antibody

    12929-50ul 50ul
    EUR 187

    ZEB1 Antibody, HRP conjugated

    1-CSB-PA026424LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    ZEB1 Antibody, FITC conjugated

    1-CSB-PA026424LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    ZEB1 Antibody, Biotin conjugated

    1-CSB-PA026424LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Anti-AREB6/ZEB1 Antibody

    A00548-2 100ug/vial
    EUR 334

    Phospho-ZEB1(Ser887) Antibody

    AF7064 200ul
    EUR 376
    Description: Phospho-ZEB1(Ser887) Antibody detects endogenous levels of ZEB1 only when phosphorylated at Ser887.

    Anti-AREB6/ZEB1 Antibody

    PA1986 100ug/vial
    EUR 294

    Anti-ZEB1 Monoclonal Antibody

    M00548 100ug
    EUR 397
    Description: Rabbit Monoclonal ZEB1 Antibody. Validated in IF, WB and tested in Human.

    Anti-AREB6 / ZEB1 antibody

    STJ71831 100 µg
    EUR 359

    ZEB1 Blocking Peptide

    DF7414-BP 1mg
    EUR 195

    ZEB1 Blocking Peptide

    AF7564-BP 1mg
    EUR 195

    ZEB1 cloning plasmid

    CSB-CL026424HU-10ug 10ug
    EUR 1202
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 3378
    • Sequence: ATGGCGGATGGCCCCAGGTGTAAGCGCAGAAAGCAGGCGAACCCGCGGCGCAATAACGTTACAAATTATAATACTGTGGTAGAAACAAATTCAGATTCAGATGATGAAGACAAACTGCATATTGTGGAAGAAGAAAGTGTTACAGATGCAGCTGACTGTGAAGGTGTACCAGAGG
    • Show more
    Description: A cloning plasmid for the ZEB1 gene.

    Monoclonal ZEB1 Antibody, Clone: 2A8A6

    APR10781G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human ZEB1. The antibodies are raised in Mouse and are from clone 2A8A6. This antibody is applicable in WB and IHC, FC, ICC, E

    Monoclonal ZEB1 Antibody, Clone: 2A8H3

    APR10782G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human ZEB1. The antibodies are raised in Mouse and are from clone 2A8H3. This antibody is applicable in WB and IHC, FC, ICC, E

    Human ZEB1 ELISA Kit

    ELA-E14970h 96 Tests
    EUR 824

    ZEB1 ELISA KIT|Human

    EF005833 96 Tests
    EUR 689

    Mouse ZEB1 shRNA Plasmid

    20-abx973029
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human ZEB1 shRNA Plasmid

    20-abx954754
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Phospho-ZEB1(Ser887) Blocking Peptide

    AF7064-BP 1mg
    EUR 195

    Zeb1 ORF Vector (Mouse) (pORF)

    ORF062179 1.0 ug DNA
    EUR 95

    Zeb1 ORF Vector (Rat) (pORF)

    ORF079360 1.0 ug DNA
    EUR 506

    h ZEB1 inducible lentiviral particles

    LVP797 1x107 IFU/ml x 200ul
    EUR 451
    Description: Pre-made over-expression lentivirus for expressing human target: h ZEB1 (zinc finger E-box binding homeobox 1), [alternative names: AREB6; BZP; DELTAEF1; FECD6; NIL2A; PPCD3; TCF8; ZFHEP; ZFHX1A]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001128128 . It also contains a RFP-Blasticidin dual selection marker.

    ZEB1 ORF Vector (Human) (pORF)

    ORF014986 1.0 ug DNA
    EUR 95

    pET28a-ZEB1(391-740aa) Plasmid

    PVTB00266-1a 2 ug
    EUR 356

    ZEB1 ELISA Kit (Chicken) (OKEH08081)

    OKEH08081 96 Wells
    EUR 1184
    Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

    Rabbit Zinc finger E box binding homeobox 1(ZEB1) ELISA kit

    E04Z0024-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger E box binding homeobox 1(ZEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Zinc finger E box binding homeobox 1(ZEB1) ELISA kit

    E04Z0024-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger E box binding homeobox 1(ZEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Zinc finger E box binding homeobox 1(ZEB1) ELISA kit

    E04Z0024-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger E box binding homeobox 1(ZEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Zeb1 sgRNA CRISPR Lentivector set (Rat)

    K6788301 3 x 1.0 ug
    EUR 339

    ZEB1 sgRNA CRISPR Lentivector set (Human)

    K2671001 3 x 1.0 ug
    EUR 339

    Zeb1 sgRNA CRISPR Lentivector set (Mouse)

    K3807701 3 x 1.0 ug
    EUR 339

    ZEB1-AS1 ORF Vector (Human) (pORF)

    ORF036112 1.0 ug DNA Ask for price

    p3*Flag-CMV-10-ZEB1 Plasmid

    PVTB00266-2b 2 ug
    EUR 356

    Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody

    abx025239-100ul 100 ul
    EUR 523
    • Shipped within 5-10 working days.

    Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody

    abx016088-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.

    Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody

    20-abx004279
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody

    abx224014-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.

    Zinc Finger E-Box Binding Homeobox 1 (ZEB1) Antibody

    20-abx116719
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody

    abx148714-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.

    Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody

    abx239620-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody

    20-abx300024
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody

    20-abx001268
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Zeb1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6788302 1.0 ug DNA
    EUR 154

    Zeb1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6788303 1.0 ug DNA
    EUR 154

    Zeb1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6788304 1.0 ug DNA
    EUR 154

    ZEB1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K2671002 1.0 ug DNA
    EUR 154

    ZEB1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K2671003 1.0 ug DNA
    EUR 154

    ZEB1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K2671004 1.0 ug DNA
    EUR 154

    Zeb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3807702 1.0 ug DNA
    EUR 154

    Zeb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3807703 1.0 ug DNA
    EUR 154

    Zeb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3807704 1.0 ug DNA
    EUR 154

    ZEB1 Protein Vector (Mouse) (pPB-C-His)

    PV248714 500 ng
    EUR 1065

    ZEB1 Protein Vector (Mouse) (pPB-N-His)

    PV248715 500 ng
    EUR 1065

    ZEB1 Protein Vector (Mouse) (pPM-C-HA)

    PV248716 500 ng
    EUR 1065

    ZEB1 Protein Vector (Mouse) (pPM-C-His)

    PV248717 500 ng
    EUR 1065

    ZEB1 Protein Vector (Rat) (pPB-C-His)

    PV317438 500 ng
    EUR 1166

    ZEB1 Protein Vector (Rat) (pPB-N-His)

    PV317439 500 ng
    EUR 1166

    ZEB1 Protein Vector (Rat) (pPM-C-HA)

    PV317440 500 ng
    EUR 1166

    ZEB1 Protein Vector (Rat) (pPM-C-His)

    PV317441 500 ng
    EUR 1166

    ZEB1 Protein Vector (Human) (pPB-C-His)

    PV059941 500 ng
    EUR 329

    ZEB1 Protein Vector (Human) (pPB-N-His)

    PV059942 500 ng
    EUR 329

    ZEB1 Rabbit Polyclonal Antibody