ZEB1 Rabbit Polyclonal Antibody

ZEB1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

ZEB1 Polyclonal Antibody
ABP60963-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ZEB1 protein Applications tips:
Description: A polyclonal antibody for detection of ZEB1 from Human, Mouse, Rat. This ZEB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZEB1 protein

ZEB1 Polyclonal Antibody
ABP60963-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ZEB1 protein Applications tips:
Description: A polyclonal antibody for detection of ZEB1 from Human, Mouse, Rat. This ZEB1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ZEB1 protein

ZEB1 Polyclonal Antibody
ES11957-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ZEB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZEB1 Polyclonal Antibody
ES11957-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ZEB1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

ZEB1 Rabbit pAb
A5600-100ul	Abclonal	100 ul	EUR 308

ZEB1 Rabbit pAb
A5600-200ul	Abclonal	200 ul	EUR 459

ZEB1 Rabbit pAb
A5600-20ul	Abclonal	20 ul	EUR 183

ZEB1 Rabbit pAb
A5600-50ul	Abclonal	50 ul	EUR 223

ZEB1 Rabbit pAb
A16981-100ul	Abclonal	100 ul	EUR 308

ZEB1 Rabbit pAb
A16981-200ul	Abclonal	200 ul	EUR 459

ZEB1 Rabbit pAb
A16981-20ul	Abclonal	20 ul	EUR 183

ZEB1 Rabbit pAb
A16981-50ul	Abclonal	50 ul	EUR 223

ZEB1 Rabbit pAb
A1500-100ul	Abclonal	100 ul	EUR 308

ZEB1 Rabbit pAb
A1500-200ul	Abclonal	200 ul	EUR 459

ZEB1 Rabbit pAb
A1500-20ul	Abclonal	20 ul	EUR 183

ZEB1 Rabbit pAb
A1500-50ul	Abclonal	50 ul	EUR 223

Polyclonal ZEB1 / AREB6 Antibody
APR03087G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ZEB1 / AREB6 . This antibody is tested and proven to work in the following applications:

ZEB1 Antibody
25144-100ul	SAB	100ul	EUR 390

ZEB1 antibody
70R-21378	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal ZEB1 antibody

ZEB1 antibody
38675-100ul	SAB	100ul	EUR 252

ZEB1 Antibody
DF7414	Affbiotech	200ul	EUR 304
Description: ZEB1 Antibody detects endogenous levels of total ZEB1.

ZEB1 Antibody
1-CSB-PA026424GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

ZEB1 Antibody
1-CSB-PA026424LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

ZEB1 Antibody
AF7564	Affbiotech	200ul	EUR 376
Description: ZEB1 Antibody detects endogenous levels of ZEB1.

ZEB1 Antibody
ABD7414	Lifescience Market	100 ug	EUR 438

Polyclonal Goat Anti-AREB6 / ZEB1 Antibody
APG00035G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-AREB6 / ZEB1 . This antibody is tested and proven to work in the following applications:

ZEB1 (Phospho-Ser887) Polyclonal Conjugated Antibody
C12929	SAB	100ul	EUR 397

anti- ZEB1 antibody
FNab09620	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000 IP: 1:200-1:2000；IHC: 1:500-1:5000 Immunogen: zinc finger E-box binding homeobox 1 Uniprot ID: P37275 Gene ID: 6935 Research Area: Metabolism
Description: Antibody raised against ZEB1

Anti-ZEB1 antibody
PAab09620	Lifescience Market	100 ug	EUR 386

Anti-ZEB1 antibody
STJ26150	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-ZEB1 antibody
STJ28276	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.

Anti-ZEB1 antibody
STJ119284	St John's Laboratory	100 µl	EUR 277

Anti-ZEB1 antibody
STJ193115	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ZEB1

Zeb1/ Rat Zeb1 ELISA Kit
ELI-40691r	Lifescience Market	96 Tests	EUR 886

ZEB1 siRNA
20-abx940363	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZEB1 siRNA
20-abx940364	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ZEB1 (Phospho-Ser887) Antibody
12929-100ul	SAB	100ul	EUR 252

ZEB1 (Phospho-Ser887) Antibody
12929-50ul	SAB	50ul	EUR 187

ZEB1 Antibody, HRP conjugated
1-CSB-PA026424LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ZEB1 Antibody, FITC conjugated
1-CSB-PA026424LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ZEB1 Antibody, Biotin conjugated
1-CSB-PA026424LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ZEB1. Recognizes ZEB1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-AREB6/ZEB1 Antibody
A00548-2	BosterBio	100ug/vial	EUR 334

Phospho-ZEB1(Ser887) Antibody
AF7064	Affbiotech	200ul	EUR 376
Description: Phospho-ZEB1(Ser887) Antibody detects endogenous levels of ZEB1 only when phosphorylated at Ser887.

Anti-AREB6/ZEB1 Antibody
PA1986	BosterBio	100ug/vial	EUR 294

Anti-ZEB1 Monoclonal Antibody
M00548	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal ZEB1 Antibody. Validated in IF, WB and tested in Human.

Anti-AREB6 / ZEB1 antibody
STJ71831	St John's Laboratory	100 µg	EUR 359

ZEB1 Blocking Peptide
DF7414-BP	Affbiotech	1mg	EUR 195

ZEB1 Blocking Peptide
AF7564-BP	Affbiotech	1mg	EUR 195

ZEB1 cloning plasmid
CSB-CL026424HU-10ug	Cusabio	10ug	EUR 1202
Formulation: 10 μg plasmid + 200μl Glycerol Length: 3378 Sequence: ATGGCGGATGGCCCCAGGTGTAAGCGCAGAAAGCAGGCGAACCCGCGGCGCAATAACGTTACAAATTATAATACTGTGGTAGAAACAAATTCAGATTCAGATGATGAAGACAAACTGCATATTGTGGAAGAAGAAAGTGTTACAGATGCAGCTGACTGTGAAGGTGTACCAGAGG Show more
Description: A cloning plasmid for the ZEB1 gene.

Monoclonal ZEB1 Antibody, Clone: 2A8A6
APR10781G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human ZEB1. The antibodies are raised in Mouse and are from clone 2A8A6. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal ZEB1 Antibody, Clone: 2A8H3
APR10782G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human ZEB1. The antibodies are raised in Mouse and are from clone 2A8H3. This antibody is applicable in WB and IHC, FC, ICC, E

Human ZEB1 ELISA Kit
ELA-E14970h	Lifescience Market	96 Tests	EUR 824

ZEB1 ELISA KIT|Human
EF005833	Lifescience Market	96 Tests	EUR 689

Mouse ZEB1 shRNA Plasmid
20-abx973029	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ZEB1 shRNA Plasmid
20-abx954754	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Phospho-ZEB1(Ser887) Blocking Peptide
AF7064-BP	Affbiotech	1mg	EUR 195

Zeb1 ORF Vector (Mouse) (pORF)
ORF062179	ABM	1.0 ug DNA	EUR 95

Zeb1 ORF Vector (Rat) (pORF)
ORF079360	ABM	1.0 ug DNA	EUR 506

h ZEB1 inducible lentiviral particles
LVP797	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing human target: h ZEB1 (zinc finger E-box binding homeobox 1), [alternative names: AREB6; BZP; DELTAEF1; FECD6; NIL2A; PPCD3; TCF8; ZFHEP; ZFHX1A]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_001128128 . It also contains a RFP-Blasticidin dual selection marker.

ZEB1 ORF Vector (Human) (pORF)
ORF014986	ABM	1.0 ug DNA	EUR 95

pET28a-ZEB1(391-740aa) Plasmid
PVTB00266-1a	Lifescience Market	2 ug	EUR 356

ZEB1 ELISA Kit (Chicken) (OKEH08081)
OKEH08081	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

Rabbit Zinc finger E box binding homeobox 1(ZEB1) ELISA kit
E04Z0024-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger E box binding homeobox 1(ZEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc finger E box binding homeobox 1(ZEB1) ELISA kit
E04Z0024-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger E box binding homeobox 1(ZEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Zinc finger E box binding homeobox 1(ZEB1) ELISA kit
E04Z0024-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Zinc finger E box binding homeobox 1(ZEB1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Zeb1 sgRNA CRISPR Lentivector set (Rat)
K6788301	ABM	3 x 1.0 ug	EUR 339

ZEB1 sgRNA CRISPR Lentivector set (Human)
K2671001	ABM	3 x 1.0 ug	EUR 339

Zeb1 sgRNA CRISPR Lentivector set (Mouse)
K3807701	ABM	3 x 1.0 ug	EUR 339

ZEB1-AS1 ORF Vector (Human) (pORF)
ORF036112	ABM	1.0 ug DNA	Ask for price

p3*Flag-CMV-10-ZEB1 Plasmid
PVTB00266-2b	Lifescience Market	2 ug	EUR 356

Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody
abx025239-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody
abx016088-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody
20-abx004279	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody
abx224014-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Zinc Finger E-Box Binding Homeobox 1 (ZEB1) Antibody
20-abx116719	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody
abx148714-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody
abx239620-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody
20-abx300024	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Zinc Finger E-Box-Binding Homeobox 1 (ZEB1) Antibody
20-abx001268	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Zeb1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6788302	ABM	1.0 ug DNA	EUR 154

Zeb1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6788303	ABM	1.0 ug DNA	EUR 154

Zeb1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6788304	ABM	1.0 ug DNA	EUR 154

ZEB1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2671002	ABM	1.0 ug DNA	EUR 154

ZEB1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2671003	ABM	1.0 ug DNA	EUR 154

ZEB1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2671004	ABM	1.0 ug DNA	EUR 154

Zeb1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3807702	ABM	1.0 ug DNA	EUR 154

Zeb1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3807703	ABM	1.0 ug DNA	EUR 154

Zeb1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3807704	ABM	1.0 ug DNA	EUR 154

ZEB1 Protein Vector (Mouse) (pPB-C-His)
PV248714	ABM	500 ng	EUR 1065

ZEB1 Protein Vector (Mouse) (pPB-N-His)
PV248715	ABM	500 ng	EUR 1065

ZEB1 Protein Vector (Mouse) (pPM-C-HA)
PV248716	ABM	500 ng	EUR 1065

ZEB1 Protein Vector (Mouse) (pPM-C-His)
PV248717	ABM	500 ng	EUR 1065

ZEB1 Protein Vector (Rat) (pPB-C-His)
PV317438	ABM	500 ng	EUR 1166

ZEB1 Protein Vector (Rat) (pPB-N-His)
PV317439	ABM	500 ng	EUR 1166

ZEB1 Protein Vector (Rat) (pPM-C-HA)
PV317440	ABM	500 ng	EUR 1166

ZEB1 Protein Vector (Rat) (pPM-C-His)
PV317441	ABM	500 ng	EUR 1166

ZEB1 Protein Vector (Human) (pPB-C-His)
PV059941	ABM	500 ng	EUR 329

ZEB1 Protein Vector (Human) (pPB-N-His)
PV059942	ABM	500 ng	EUR 329

ZEB1 Rabbit Polyclonal Antibody