P2RY6 Rabbit Polyclonal Antibody

P2RY6 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    P2RY6 Polyclonal Antibody

    ABP59790-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260
    • Applications tips:
    Description: A polyclonal antibody for detection of P2RY6 from Human, Mouse, Rat. This P2RY6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260

    P2RY6 Polyclonal Antibody

    ABP59790-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260
    • Applications tips:
    Description: A polyclonal antibody for detection of P2RY6 from Human, Mouse, Rat. This P2RY6 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human P2RY6 protein at amino acid sequence of 180-260

    P2RY6 Rabbit pAb

    A2485-100ul 100 ul
    EUR 308

    P2RY6 Rabbit pAb

    A2485-200ul 200 ul
    EUR 459

    P2RY6 Rabbit pAb

    A2485-20ul 20 ul
    EUR 183

    P2RY6 Rabbit pAb

    A2485-50ul 50 ul
    EUR 223

    P2RY6 Antibody

    ABD6956 100 ug
    EUR 438

    P2RY6 Antibody

    37009-100ul 100ul
    EUR 252

    P2RY6 antibody

    38404-100ul 100ul
    EUR 252

    P2RY6 antibody

    70R-19080 50 ul
    EUR 435
    Description: Rabbit polyclonal P2RY6 antibody

    P2RY6 Antibody

    DF6956 200ul
    EUR 304
    Description: P2RY6 Antibody detects endogenous levels of total P2RY6.

    P2RY6 Antibody

    1-CSB-PA977071
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:100-1:300

    P2RY6 Antibody

    1-CSB-PA576070
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

    P2RY6 Antibody

    1-CSB-PA017337GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against P2RY6. Recognizes P2RY6 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    Polyclonal P2RY6 Antibody (C-term)

    APR17718G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 (C-term). This antibody is tested and proven to work in the following applications:

    P2ry6/ Rat P2ry6 ELISA Kit

    ELI-37027r 96 Tests
    EUR 886

    Polyclonal P2RY6 / P2Y6 Antibody (C-Terminus)

    APR17716G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 / P2Y6 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal P2RY6 / P2Y6 Antibody (Cytoplasmic Domain)

    APR17717G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 / P2Y6 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

    Polyclonal P2RY6 Antibody - N-terminal region

    APR17719G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY6 - N-terminal region. This antibody is tested and proven to work in the following applications:

    P2RY6 Conjugated Antibody

    C37009 100ul
    EUR 397

    P2RY6 Conjugated Antibody

    C38404 100ul
    EUR 397

    anti- P2RY6 antibody

    FNab06074 100µg
    EUR 548.75
    • Immunogen: pyrimidinergic receptor P2Y, G-protein coupled, 6
    • Uniprot ID: Q15077
    • Research Area: Signal Transduction
    Description: Antibody raised against P2RY6

    Anti-P2RY6 antibody

    PAab06074 100 ug
    EUR 386

    Anti-P2RY6 antibody

    STJ24878 100 µl
    EUR 277
    Description: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

    Anti-P2RY6 antibody

    STJ192780 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to P2RY6

    P2RY6 siRNA

    20-abx903807
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    P2RY6 siRNA

    20-abx927553
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    P2RY6 siRNA

    20-abx927554
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    P2RY6 cloning plasmid

    CSB-CL618975HU-10ug 10ug
    EUR 385
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 987
    • Sequence: atggaatgggacaatggcacaggccaggctctgggcttgccacccaccacctgtgtctaccgcgagaacttcaagcaactgctgctgccacctgtgtattcggcggtgctggcggctggcctgccgctgaacatctgtgtcattacccagatctgcacgtcccgccgggccctgac
    • Show more
    Description: A cloning plasmid for the P2RY6 gene.

    P2RY6 Blocking Peptide

    DF6956-BP 1mg
    EUR 195

    Rat P2RY6 shRNA Plasmid

    20-abx987437
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    P2RY6 ELISA KIT|Human

    EF001499 96 Tests
    EUR 689

    Human P2RY6 shRNA Plasmid

    20-abx953344
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse P2RY6 shRNA Plasmid

    20-abx982061
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    P2RY6 Recombinant Protein (Human)

    RP022372 100 ug Ask for price

    P2RY6 Recombinant Protein (Rat)

    RP219089 100 ug Ask for price

    P2RY6 Recombinant Protein (Mouse)

    RP159806 100 ug Ask for price

    P2RY6 ORF Vector (Human) (pORF)

    ORF007458 1.0 ug DNA
    EUR 95

    P2ry6 ORF Vector (Rat) (pORF)

    ORF073031 1.0 ug DNA
    EUR 506

    P2ry6 ORF Vector (Mouse) (pORF)

    ORF053270 1.0 ug DNA
    EUR 506

    P2RY6 sgRNA CRISPR Lentivector set (Human)

    K1582401 3 x 1.0 ug
    EUR 339

    P2ry6 sgRNA CRISPR Lentivector set (Mouse)

    K3768301 3 x 1.0 ug
    EUR 339

    P2ry6 sgRNA CRISPR Lentivector set (Rat)

    K7076901 3 x 1.0 ug
    EUR 339

    Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

    20-abx001929
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

    abx028562-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

    abx028562-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

    20-abx214648
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

    20-abx214804
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 6 (P2RY6) Antibody

    abx236074-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Mouse P2Y purinoceptor 6, P2ry6 ELISA KIT

    ELI-35729m 96 Tests
    EUR 865

    Human P2Y purinoceptor 6, P2RY6 ELISA KIT

    ELI-43275h 96 Tests
    EUR 824

    P2RY6 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1582402 1.0 ug DNA
    EUR 154

    P2RY6 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1582403 1.0 ug DNA
    EUR 154

    P2RY6 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1582404 1.0 ug DNA
    EUR 154

    P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3768302 1.0 ug DNA
    EUR 154

    P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3768303 1.0 ug DNA
    EUR 154

    P2ry6 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3768304 1.0 ug DNA
    EUR 154

    P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7076902 1.0 ug DNA
    EUR 154

    P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7076903 1.0 ug DNA
    EUR 154

    P2ry6 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7076904 1.0 ug DNA
    EUR 154

    P2RY6 Protein Vector (Human) (pPB-C-His)

    PV029829 500 ng
    EUR 329

    P2RY6 Protein Vector (Human) (pPB-N-His)

    PV029830 500 ng
    EUR 329

    P2RY6 Protein Vector (Human) (pPM-C-HA)

    PV029831 500 ng
    EUR 329

    P2RY6 Protein Vector (Human) (pPM-C-His)

    PV029832 500 ng
    EUR 329

    P2RY6 Protein Vector (Mouse) (pPB-C-His)

    PV213078 500 ng
    EUR 603

    P2RY6 Protein Vector (Mouse) (pPB-N-His)

    PV213079 500 ng
    EUR 603

    P2RY6 Protein Vector (Mouse) (pPM-C-HA)

    PV213080 500 ng
    EUR 603

    P2RY6 Protein Vector (Mouse) (pPM-C-His)

    PV213081 500 ng
    EUR 603

    P2RY6 Protein Vector (Rat) (pPB-C-His)

    PV292122 500 ng
    EUR 603

    P2RY6 Protein Vector (Rat) (pPB-N-His)

    PV292123 500 ng
    EUR 603

    P2RY6 Rabbit Polyclonal Antibody