IMMT Rabbit Polyclonal Antibody

IMMT Rabbit Polyclonal Antibody

Contact Us Below To Order :

    IMMT Rabbit pAb

    A14107-100ul 100 ul
    EUR 308

    IMMT Rabbit pAb

    A14107-200ul 200 ul
    EUR 459

    IMMT Rabbit pAb

    A14107-20ul 20 ul
    EUR 183

    IMMT Rabbit pAb

    A14107-50ul 50 ul
    EUR 223

    IMMT Rabbit pAb

    A4471-100ul 100 ul
    EUR 308

    IMMT Rabbit pAb

    A4471-200ul 200 ul
    EUR 459

    IMMT Rabbit pAb

    A4471-20ul 20 ul Ask for price

    IMMT Rabbit pAb

    A4471-50ul 50 ul Ask for price

    IMMT Rabbit pAb

    A2751-100ul 100 ul
    EUR 308

    IMMT Rabbit pAb

    A2751-200ul 200 ul
    EUR 459

    IMMT Rabbit pAb

    A2751-20ul 20 ul
    EUR 183

    IMMT Rabbit pAb

    A2751-50ul 50 ul
    EUR 223

    Polyclonal IMMT Antibody (Center)

    APR07991G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications:

    Polyclonal IMMT Antibody (Center)

    APR07992G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human IMMT (Center). This antibody is tested and proven to work in the following applications:

    IMMT Antibody

    31090-100ul 100ul
    EUR 252

    IMMT Antibody

    31090-50ul 50ul
    EUR 187

    IMMT antibody

    70R-17962 50 ul
    EUR 435
    Description: Rabbit polyclonal IMMT antibody

    IMMT antibody

    38458-100ul 100ul
    EUR 252

    IMMT Antibody

    1-CSB-PA598310
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:15-1:50

    IMMT Antibody

    1-CSB-PA623101LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF, IP; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200, IP:1:200-1:2000

    IMMT Antibody

    1-CSB-PA985538
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

    IMMT Antibody

    DF7074 200ul
    EUR 304
    Description: IMMT Antibody detects endogenous levels of total IMMT.

    IMMT Antibody

    1-CSB-PA011690GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    IMMT Antibody

    ABD7074 100 ug
    EUR 438

    Mitofilin (IMMT) Antibody

    20-abx008293
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody

    20-abx003344
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody

    20-abx213137
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody

    20-abx213329
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody

    20-abx113139
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody

    abx036116-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody

    abx031803-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody

    abx031803-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    IMMT Conjugated Antibody

    C31090 100ul
    EUR 397

    IMMT Conjugated Antibody

    C38458 100ul
    EUR 397

    Mitofilin (IMMT) Antibody

    abx235199-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Mitofilin (IMMT) Antibody

    20-abx302625
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody

    20-abx002081
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anti-IMMT antibody

    STJ24199 100 µl
    EUR 277

    Anti-IMMT antibody

    STJ24200 100 µl
    EUR 277

    Anti-IMMT antibody

    STJ116042 100 µl
    EUR 277

    Anti-IMMT antibody

    STJ193003 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to IMMT

    Immt/ Rat Immt ELISA Kit

    ELI-43729r 96 Tests
    EUR 886

    IMMT siRNA

    20-abx902673
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    IMMT siRNA

    20-abx920570
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    IMMT siRNA

    20-abx920571
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    pOTB7-IMMT

    PVT18623 2 ug
    EUR 258

    IMMT Antibody, HRP conjugated

    1-CSB-PA623101LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    IMMT Antibody, FITC conjugated

    1-CSB-PA623101LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    IMMT Antibody, Biotin conjugated

    1-CSB-PA623101LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against IMMT. Recognizes IMMT from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Mitofilin (IMMT) Antibody (HRP)

    20-abx317405
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody (FITC)

    20-abx317406
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Mitofilin (IMMT) Antibody (Biotin)

    20-abx317407
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    IMMT Blocking Peptide

    DF7074-BP 1mg
    EUR 195

    IMMT cloning plasmid

    CSB-CL623101HU-10ug 10ug
    EUR 474
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2277
    • Sequence: atgctgcgggcctgtcagttatcgggtgtgaccgccgccgcccagagttgtctctgtgggaagtttgtcctccgtccattgcgaccatgccgcagatactctacttcaggcagctctgggttgactactggcaaaattgctggagctggccttttgtttgttggtggaggtattg
    • Show more
    Description: A cloning plasmid for the IMMT gene.

    Rat IMMT shRNA Plasmid

    20-abx989719
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse IMMT shRNA Plasmid

    20-abx978650
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human IMMT shRNA Plasmid

    20-abx957504
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    IMMT Recombinant Protein (Human)

    RP016108 100 ug Ask for price

    IMMT Recombinant Protein (Rat)

    RP205973 100 ug Ask for price

    IMMT Recombinant Protein (Mouse)

    RP143741 100 ug Ask for price

    IMMT Recombinant Protein (Mouse)

    RP143744 100 ug Ask for price

    IMMT Recombinant Protein (Mouse)

    RP143747 100 ug Ask for price

    IMMT Recombinant Protein (Mouse)

    RP143750 100 ug Ask for price

    IMMT Recombinant Protein (Mouse)

    RP143753 100 ug Ask for price

    IMMT Recombinant Protein (Mouse)

    RP143756 100 ug Ask for price

    Human Mitofilin (IMMT) ELISA Kit

    abx259696-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Immt ORF Vector (Rat) (pORF)

    ORF068659 1.0 ug DNA
    EUR 506

    IMMT ORF Vector (Human) (pORF)

    ORF005370 1.0 ug DNA
    EUR 95

    Immt ORF Vector (Mouse) (pORF)

    ORF047915 1.0 ug DNA
    EUR 506

    Immt ORF Vector (Mouse) (pORF)

    ORF047916 1.0 ug DNA
    EUR 506

    Immt ORF Vector (Mouse) (pORF)

    ORF047917 1.0 ug DNA
    EUR 506

    Immt ORF Vector (Mouse) (pORF)

    ORF047918 1.0 ug DNA
    EUR 506

    Immt ORF Vector (Mouse) (pORF)

    ORF047919 1.0 ug DNA
    EUR 506

    Immt ORF Vector (Mouse) (pORF)

    ORF047920 1.0 ug DNA
    EUR 506

    Immt sgRNA CRISPR Lentivector set (Rat)

    K7307201 3 x 1.0 ug
    EUR 339

    Immt sgRNA CRISPR Lentivector set (Mouse)

    K4633301 3 x 1.0 ug
    EUR 339

    IMMT sgRNA CRISPR Lentivector set (Human)

    K1084601 3 x 1.0 ug
    EUR 339

    Immt sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7307202 1.0 ug DNA
    EUR 154

    Immt sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7307203 1.0 ug DNA
    EUR 154

    Immt sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7307204 1.0 ug DNA
    EUR 154

    Immt sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4633302 1.0 ug DNA
    EUR 154

    Immt sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4633303 1.0 ug DNA
    EUR 154

    Immt sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4633304 1.0 ug DNA
    EUR 154

    IMMT sgRNA CRISPR Lentivector (Human) (Target 1)

    K1084602 1.0 ug DNA
    EUR 154

    IMMT sgRNA CRISPR Lentivector (Human) (Target 2)

    K1084603 1.0 ug DNA
    EUR 154

    IMMT sgRNA CRISPR Lentivector (Human) (Target 3)

    K1084604 1.0 ug DNA
    EUR 154

    IMMT Protein Vector (Human) (pPB-C-His)

    PV021477 500 ng
    EUR 329

    IMMT Protein Vector (Human) (pPB-N-His)

    PV021478 500 ng
    EUR 329

    IMMT Protein Vector (Human) (pPM-C-HA)

    PV021479 500 ng
    EUR 329

    IMMT Protein Vector (Human) (pPM-C-His)

    PV021480 500 ng
    EUR 329

    IMMT Protein Vector (Rat) (pPB-C-His)

    PV274634 500 ng
    EUR 603

    IMMT Protein Vector (Rat) (pPB-N-His)

    PV274635 500 ng
    EUR 603

    IMMT Protein Vector (Rat) (pPM-C-HA)

    PV274636 500 ng
    EUR 603

    IMMT Protein Vector (Rat) (pPM-C-His)

    PV274637 500 ng
    EUR 603

    IMMT Protein Vector (Mouse) (pPB-C-His)

    PV191658 500 ng
    EUR 1065

    IMMT Rabbit Polyclonal Antibody