PTMA Rabbit Polyclonal Antibody

PTMA Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PTMA Polyclonal Antibody

    ES11817-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against PTMA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Human Prothymosin Alpha (PTMa) ELISA Kit

    DLR-PTMa-Hu-48T 48T
    EUR 517
    • Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Prothymosin Alpha (PTMa) ELISA Kit

    DLR-PTMa-Hu-96T 96T
    EUR 673
    • Should the Human Prothymosin Alpha (PTMa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Prothymosin Alpha (PTMa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

    Human Prothymosin Alpha (PTMa) ELISA Kit

    RDR-PTMa-Hu-48Tests 48 Tests
    EUR 544

    Human Prothymosin Alpha (PTMa) ELISA Kit

    RDR-PTMa-Hu-96Tests 96 Tests
    EUR 756

    Human Prothymosin Alpha (PTMa) ELISA Kit

    RD-PTMa-Hu-48Tests 48 Tests
    EUR 521

    Human Prothymosin Alpha (PTMa) ELISA Kit

    RD-PTMa-Hu-96Tests 96 Tests
    EUR 723

    PTMA Rabbit pAb

    A1956-100ul 100 ul
    EUR 308

    PTMA Rabbit pAb

    A1956-200ul 200 ul
    EUR 459

    PTMA Rabbit pAb

    A1956-20ul 20 ul
    EUR 183

    PTMA Rabbit pAb

    A1956-50ul 50 ul
    EUR 223

    PTMA antibody

    70R-19633 50 ul
    EUR 435
    Description: Rabbit polyclonal PTMA antibody

    PTMA Antibody

    37277-100ul 100ul
    EUR 252

    PTMA Antibody

    1-CSB-PA721303
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    PTMA Antibody

    1-CSB-PA799716
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    PTMA Antibody

    1-CSB-PA272943
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

    PTMA Antibody

    1-CSB-PA01524A0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    PTMA Antibody

    1-CSB-PA019000GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC

    Polyclonal PTMA Antibody (N-term)

    APR03615G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTMA (N-term). This antibody is tested and proven to work in the following applications:

    Polyclonal PTMA Antibody (C-Term)

    APG00574G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Term). This antibody is tested and proven to work in the following applications:

    Polyclonal PTMA Antibody (C-Terminus)

    APG01175G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human PTMA (C-Terminus). This antibody is tested and proven to work in the following applications:

    PTMA Polyclonal Antibody, Biotin Conjugated

    A52461 100 µg
    EUR 570.55
    Description: Ask the seller for details

    PTMA Polyclonal Antibody, FITC Conjugated

    A52462 100 µg
    EUR 570.55
    Description: The best epigenetics products

    PTMA Polyclonal Antibody, HRP Conjugated

    A52463 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    PTMA

    E541-447 100ug
    EUR 343

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human)

    4-PAD221Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa)

    PTMA Conjugated Antibody

    C37277 100ul
    EUR 397

    Monoclonal PTMA Antibody

    AMM01760G 0.05mg
    EUR 484
    Description: A Monoclonal antibody against Human PTMA. The antibodies are raised in Mouse. This antibody is applicable in WB and IHC-P, ICC, IP

    Anti-PTMA antibody

    STJ11100717 100 µl
    EUR 277

    Anti-PTMA antibody

    STJ192975 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PTMA

    Anti-PTMA antibody

    STJ71788 100 µg
    EUR 359

    Ptma/ Rat Ptma ELISA Kit

    ELI-05265r 96 Tests
    EUR 657

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC

    4-PAD221Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Biotinylated

    4-PAD221Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Biotin.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), Cy3

    4-PAD221Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with Cy3.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), FITC

    4-PAD221Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with FITC.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), HRP

    4-PAD221Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with HRP.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), PE

    4-PAD221Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with PE.

    PTMA siRNA

    20-abx904361
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTMA siRNA

    20-abx930331
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTMA siRNA

    20-abx930332
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTMA Antibody, HRP conjugated

    1-CSB-PA01524B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    PTMA Antibody, FITC conjugated

    1-CSB-PA01524C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    PTMA Antibody, Biotin conjugated

    1-CSB-PA01524D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTMA. Recognizes PTMA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Prothymosin Alpha (PTMA) Antibody

    abx026432-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    abx026432-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    20-abx110156
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    20-abx121680
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMa) Antibody

    20-abx128206
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Prothymosin Alpha (PTMa) Antibody

    20-abx174300
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Prothymosin Alpha (PTMA) Antibody

    20-abx241156
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    20-abx241411
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    20-abx241412
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Prothymosin Alpha (PTMA) Antibody

    abx236808-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Prothymosin Alpha (PTMA) Antibody

    abx431948-200ul 200 ul
    EUR 286
    • Shipped within 1-3 working days.

    Prothymosin Alpha (PTMa) Polyclonal Antibody (Human), APC-Cy7

    4-PAD221Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: PTMa (Ser2~Asp111)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Prothymosin Alpha (PTMa). This antibody is labeled with APC-Cy7.

    PTMA cloning plasmid

    CSB-CL019000HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 333
    • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
    • Show more
    Description: A cloning plasmid for the PTMA gene.

    PTMA cloning plasmid

    CSB-CL019000HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 333
    • Sequence: atgtcagacgcagccgtagacaccagctccgaaatcaccaccaaggacttaaaggagaagaaggaagttgtggaagaggcagaaaatggaagagacgcccctgctaacgggaatgctaatgaggaaaatggggagcaggaggctgacaatgaggtagacgaagaagaggaagaagg
    • Show more
    Description: A cloning plasmid for the PTMA gene.

    Human Prothymosin alpha (PTMA)

    1-CSB-YP019000HU
    • EUR 430.00
    • EUR 234.00
    • EUR 1508.00
    • EUR 642.00
    • EUR 1009.00
    • EUR 291.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.2 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

    Human Prothymosin alpha (PTMA)

    1-CSB-YP019000HUb0
    • EUR 430.00
    • EUR 234.00
    • EUR 1508.00
    • EUR 642.00
    • EUR 1009.00
    • EUR 291.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.7 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Prothymosin alpha(PTMA) expressed in Yeast

    Rat Prothymosin alpha (Ptma)

    1-CSB-YP019000RA
    • EUR 504.00
    • EUR 265.00
    • EUR 1832.00
    • EUR 763.00
    • EUR 1216.00
    • EUR 334.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 14.3 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Rat Prothymosin alpha(Ptma) expressed in Yeast

    PTMA protein (His tag)

    80R-3024 50 ug
    EUR 413
    Description: Purified recombinant PTMA protein (His tag)

    Human PTMA ELISA Kit

    ELA-E1609h 96 Tests
    EUR 824

    PTMA ELISA KIT|Human

    EF005969 96 Tests
    EUR 689

    Mouse PTMA shRNA Plasmid

    20-abx972279
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat PTMA shRNA Plasmid

    20-abx985361
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Prothymosin Alpha (PTMA) Protein

    20-abx262698
    • EUR 328.00
    • EUR 6397.00
    • EUR 230.00
    • 10 ug
    • 1 mg
    • 2 µg
    • Shipped within 5-10 working days.

    Human PTMA shRNA Plasmid

    20-abx953893
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Recombinant Prothymosin Alpha (PTMa)

    4-RPD221Hu01
    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P06454
    • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 42.1kDa
    • Isoelectric Point: 3.7
    Description: Recombinant Human Prothymosin Alpha expressed in: E.coli

    Recombinant Prothymosin Alpha (PTMa)

    4-RPD221Ra01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Inquire
    • Buffer composition: 100mMNaHCO3, 500mMNaCl, pH8.3, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 42.2kDa
    • Isoelectric Point: 3.7
    Description: Recombinant Rat Recombinant Prothymosin Alpha (PTMa) expressed in: E.coli

    PTMA Recombinant Protein (Human)

    RP025144 100 ug Ask for price

    PTMA Recombinant Protein (Human)

    RP025147 100 ug Ask for price

    PTMA Recombinant Protein (Mouse)

    RP165578 100 ug Ask for price

    PTMA Recombinant Protein (Rat)

    RP222875 100 ug Ask for price

    Monoclonal PTMA Antibody (monoclonal) (M02), Clone: 1G8

    AMM03967G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human PTMA (monoclonal) (M02). The antibodies are raised in mouse and are from clone 1G8. This antibody is applicable in WB, E

    Human Prothymosin Alpha (PTMA) Protein

    abx060044-100ug 100 ug
    EUR 328
    • Shipped within 5-10 working days.

    Human Prothymosin Alpha (PTMa) Protein

    20-abx166598
    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Rat Prothymosin Alpha (PTMa) Protein

    20-abx654881
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Ptma ORF Vector (Rat) (pORF)

    ORF074293 1.0 ug DNA
    EUR 506

    PTMA ORF Vector (Human) (pORF)

    ORF008382 1.0 ug DNA
    EUR 95

    PTMA ORF Vector (Human) (pORF)

    ORF008383 1.0 ug DNA
    EUR 95

    Ptma ORF Vector (Mouse) (pORF)

    ORF055194 1.0 ug DNA
    EUR 506

    PTMA ELISA Kit (Human) (OKCD08419)

    OKCD08419 96 Wells
    EUR 975
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

    PTMA ELISA Kit (Human) (OKEH01154)

    OKEH01154 96 Wells
    EUR 662
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.039 ng/mL

    PTMA ELISA Kit (Rat) (OKEH06132)

    OKEH06132 96 Wells
    EUR 662
    Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.166 ng/mL

    PTMA ELISA Kit (Mouse) (OKEH04264)

    OKEH04264 96 Wells
    EUR 662
    Description: Description of target: Prothymosin alpha may mediate immune function by conferring resistance to certain opportunistic infections.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.164 ng/mL

    Human Prothymosin Alpha (PTMa)ELISA kit

    201-12-2264 96 tests
    EUR 440
    • This Prothymosin Alpha ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Human Prothymosin alpha (PTMa) ELISA Kit

    20-abx152865
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Prothymosin alpha (PTMA) ELISA Kit

    abx251157-96tests 96 tests
    EUR 746
    • Shipped within 5-12 working days.

    Mouse Ptma/ Prothymosin alpha ELISA Kit

    E1227Mo 1 Kit
    EUR 571

    Human PTMA/ Prothymosin alpha ELISA Kit

    E2090Hu 1 Kit
    EUR 571

    Human PTMA(Prothymosin alpha) ELISA Kit

    EH1845 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P06454
    • Alias: PTMA/Prothymosin alpha/TMSA
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Bovine Prothymosin alpha, PTMA ELISA KIT

    ELI-05262b 96 Tests
    EUR 928

    Mouse Prothymosin alpha, Ptma ELISA KIT

    ELI-05263m 96 Tests
    EUR 865

    Human Prothymosin alpha, PTMA ELISA KIT

    ELI-05264h 96 Tests
    EUR 824

    PTMA Rabbit Polyclonal Antibody