GPR84 Rabbit Polyclonal Antibody

GPR84 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GPR84 Polyclonal Antibody
    A67298 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Polyclonal GPR84 Antibody (Center)
    APR16623G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Center). This antibody is tested and proven to work in the following applications:
    GPR84 Antibody
    ABD2769 100 ug
    EUR 438
    GPR84 Antibody
    ABD2811 100 ug
    EUR 438
    GPR84 Antibody
    44971-100ul 100ul
    EUR 252
    GPR84 Antibody
    44971-50ul 50ul
    EUR 187
    GPR84 Antibody
    DF2769 200ul
    EUR 304
    Description: GPR84 antibody detects endogenous levels of total GPR84.
    GPR84 Antibody
    DF2811 200ul
    EUR 304
    Description: GPR84 antibody detects endogenous levels of total GPR84.
    GPR84 Antibody
    1-CSB-PA865107LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
    Polyclonal GPR84 Antibody (Cytoplasmic Domain)
    APR16624G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
    Polyclonal GPR84 Antibody (Extracellular Domain)
    APR16625G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Extracellular Domain). This antibody is tested and proven to work in the following applications:
    GPR84 Polyclonal Antibody, HRP Conjugated
    A67299 100 µg
    EUR 570.55
    Description: kits suitable for this type of research
    GPR84 Polyclonal Antibody, FITC Conjugated
    A67300 100 µg
    EUR 570.55
    Description: fast delivery possible
    GPR84 Polyclonal Antibody, Biotin Conjugated
    A67301 100 µg
    EUR 570.55
    Description: reagents widely cited
    GPR84 Conjugated Antibody
    C44971 100ul
    EUR 397
    GPR84 Antibody (HRP)
    20-abx310835
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    GPR84 Antibody (FITC)
    20-abx310836
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    GPR84 Antibody (Biotin)
    20-abx310837
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Anti-GPR84 antibody
    STJ192641 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GPR84
    GPR84 siRNA
    20-abx918560
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GPR84 siRNA
    20-abx918561
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GPR84 Antibody, HRP conjugated
    1-CSB-PA865107LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    GPR84 Antibody, FITC conjugated
    1-CSB-PA865107LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    GPR84 Antibody, Biotin conjugated
    1-CSB-PA865107LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    GPR84 antagonist 8
    HY-112562 10mM/1mL
    EUR 744
    GPR84 cloning plasmid
    CSB-CL865107HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1191
    • Sequence: atgtggaacagctctgacgccaacttctcctgctaccatgagtctgtgctgggctatcgttatgttgcagttagctggggggtggtggtggctgtgacaggcaccgtgggcaatgtgctcaccctactggccttggccatccagcccaagctccgtacccgattcaacctgctca
    • Show more
    Description: A cloning plasmid for the GPR84 gene.
    GPR84 Blocking Peptide
    DF2769-BP 1mg
    EUR 195
    GPR84 Blocking Peptide
    DF2811-BP 1mg
    EUR 195
    pET24a-GPR84 Plasmid
    PVTB50010-1a 2 ug
    EUR 356
    Mouse GPR84 shRNA Plasmid
    20-abx979070
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human GPR84 shRNA Plasmid
    20-abx959986
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    GPR84 Recombinant Protein (Human)
    RP013903 100 ug Ask for price
    pCMV-SPORT6-Gpr84 Plasmid
    PVTB50010S 2 ug
    EUR 356
    GPR84 Recombinant Protein (Rat)
    RP203474 100 ug Ask for price
    GPR84 Recombinant Protein (Mouse)
    RP139724 100 ug Ask for price
    Monoclonal GPR84 Antibody (monoclonal) (M02), Clone: 5B7
    APR16626G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human GPR84 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 5B7. This antibody is applicable in WB, E
    Monoclonal GPR84 Antibody (monoclonal) (M03), Clone: 1D9
    APR16627G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human GPR84 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1D9. This antibody is applicable in WB, E
    G-Protein Coupled Receptor 84 (GPR84) Antibody
    20-abx147333
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    G-Protein Coupled Receptor 84 (GPR84) Antibody
    abx029499-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    G-Protein Coupled Receptor 84 (GPR84) Antibody
    abx029499-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    G-Protein Coupled Receptor 84 (GPR84) Antibody
    20-abx310834
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    GPR84 ORF Vector (Human) (pORF)
    ORF004635 1.0 ug DNA
    EUR 95
    Gpr84 ORF Vector (Rat) (pORF)
    ORF067826 1.0 ug DNA
    EUR 506
    Gpr84 ORF Vector (Mouse) (pORF)
    ORF046576 1.0 ug DNA
    EUR 506
    GPR84 sgRNA CRISPR Lentivector set (Human)
    K0893501 3 x 1.0 ug
    EUR 339
    Gpr84 sgRNA CRISPR Lentivector set (Mouse)
    K3260601 3 x 1.0 ug
    EUR 339
    Gpr84 sgRNA CRISPR Lentivector set (Rat)
    K6609101 3 x 1.0 ug
    EUR 339
    GPR84 sgRNA CRISPR Lentivector (Human) (Target 1)
    K0893502 1.0 ug DNA
    EUR 154
    GPR84 sgRNA CRISPR Lentivector (Human) (Target 2)
    K0893503 1.0 ug DNA
    EUR 154
    GPR84 sgRNA CRISPR Lentivector (Human) (Target 3)
    K0893504 1.0 ug DNA
    EUR 154
    Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3260602 1.0 ug DNA
    EUR 154
    Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3260603 1.0 ug DNA
    EUR 154
    Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3260604 1.0 ug DNA
    EUR 154
    Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6609102 1.0 ug DNA
    EUR 154
    Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6609103 1.0 ug DNA
    EUR 154
    Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6609104 1.0 ug DNA
    EUR 154
    GPR84 Protein Vector (Rat) (pPB-C-His)
    PV271302 500 ng
    EUR 603
    GPR84 Protein Vector (Rat) (pPB-N-His)
    PV271303 500 ng
    EUR 603

    GPR84 Rabbit Polyclonal Antibody