GPR84 Rabbit Polyclonal Antibody

GPR84 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR84 Polyclonal Antibody
A67298	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Polyclonal GPR84 Antibody (Center)
APR16623G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Center). This antibody is tested and proven to work in the following applications:

GPR84 Antibody
ABD2769	Lifescience Market	100 ug	EUR 438

GPR84 Antibody
ABD2811	Lifescience Market	100 ug	EUR 438

GPR84 Antibody
44971-100ul	SAB	100ul	EUR 252

GPR84 Antibody
44971-50ul	SAB	50ul	EUR 187

GPR84 Antibody
DF2769	Affbiotech	200ul	EUR 304
Description: GPR84 antibody detects endogenous levels of total GPR84.

GPR84 Antibody
DF2811	Affbiotech	200ul	EUR 304
Description: GPR84 antibody detects endogenous levels of total GPR84.

GPR84 Antibody
1-CSB-PA865107LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Polyclonal GPR84 Antibody (Cytoplasmic Domain)
APR16624G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR84 Antibody (Extracellular Domain)
APR16625G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR84 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

GPR84 Polyclonal Antibody, HRP Conjugated
A67299	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

GPR84 Polyclonal Antibody, FITC Conjugated
A67300	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

GPR84 Polyclonal Antibody, Biotin Conjugated
A67301	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

GPR84 Conjugated Antibody
C44971	SAB	100ul	EUR 397

GPR84 Antibody (HRP)
20-abx310835	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GPR84 Antibody (FITC)
20-abx310836	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GPR84 Antibody (Biotin)
20-abx310837	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-GPR84 antibody
STJ192641	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GPR84

GPR84 siRNA
20-abx918560	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR84 siRNA
20-abx918561	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GPR84 Antibody, HRP conjugated
1-CSB-PA865107LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPR84 Antibody, FITC conjugated
1-CSB-PA865107LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPR84 Antibody, Biotin conjugated
1-CSB-PA865107LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR84. Recognizes GPR84 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPR84 antagonist 8
HY-112562	MedChemExpress	10mM/1mL	EUR 744

GPR84 cloning plasmid
CSB-CL865107HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1191 Sequence: atgtggaacagctctgacgccaacttctcctgctaccatgagtctgtgctgggctatcgttatgttgcagttagctggggggtggtggtggctgtgacaggcaccgtgggcaatgtgctcaccctactggccttggccatccagcccaagctccgtacccgattcaacctgctca Show more
Description: A cloning plasmid for the GPR84 gene.

GPR84 Blocking Peptide
DF2769-BP	Affbiotech	1mg	EUR 195

GPR84 Blocking Peptide
DF2811-BP	Affbiotech	1mg	EUR 195

pET24a-GPR84 Plasmid
PVTB50010-1a	Lifescience Market	2 ug	EUR 356

Mouse GPR84 shRNA Plasmid
20-abx979070	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GPR84 shRNA Plasmid
20-abx959986	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GPR84 Recombinant Protein (Human)
RP013903	ABM	100 ug	Ask for price

pCMV-SPORT6-Gpr84 Plasmid
PVTB50010S	Lifescience Market	2 ug	EUR 356

GPR84 Recombinant Protein (Rat)
RP203474	ABM	100 ug	Ask for price

GPR84 Recombinant Protein (Mouse)
RP139724	ABM	100 ug	Ask for price

Monoclonal GPR84 Antibody (monoclonal) (M02), Clone: 5B7
APR16626G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human GPR84 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 5B7. This antibody is applicable in WB, E

Monoclonal GPR84 Antibody (monoclonal) (M03), Clone: 1D9
APR16627G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human GPR84 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 1D9. This antibody is applicable in WB, E

G-Protein Coupled Receptor 84 (GPR84) Antibody
20-abx147333	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

G-Protein Coupled Receptor 84 (GPR84) Antibody
abx029499-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

G-Protein Coupled Receptor 84 (GPR84) Antibody
abx029499-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

G-Protein Coupled Receptor 84 (GPR84) Antibody
20-abx310834	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

GPR84 ORF Vector (Human) (pORF)
ORF004635	ABM	1.0 ug DNA	EUR 95

Gpr84 ORF Vector (Rat) (pORF)
ORF067826	ABM	1.0 ug DNA	EUR 506

Gpr84 ORF Vector (Mouse) (pORF)
ORF046576	ABM	1.0 ug DNA	EUR 506

GPR84 sgRNA CRISPR Lentivector set (Human)
K0893501	ABM	3 x 1.0 ug	EUR 339

Gpr84 sgRNA CRISPR Lentivector set (Mouse)
K3260601	ABM	3 x 1.0 ug	EUR 339

Gpr84 sgRNA CRISPR Lentivector set (Rat)
K6609101	ABM	3 x 1.0 ug	EUR 339

GPR84 sgRNA CRISPR Lentivector (Human) (Target 1)
K0893502	ABM	1.0 ug DNA	EUR 154

GPR84 sgRNA CRISPR Lentivector (Human) (Target 2)
K0893503	ABM	1.0 ug DNA	EUR 154

GPR84 sgRNA CRISPR Lentivector (Human) (Target 3)
K0893504	ABM	1.0 ug DNA	EUR 154

Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3260602	ABM	1.0 ug DNA	EUR 154

Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3260603	ABM	1.0 ug DNA	EUR 154

Gpr84 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3260604	ABM	1.0 ug DNA	EUR 154

Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6609102	ABM	1.0 ug DNA	EUR 154

Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6609103	ABM	1.0 ug DNA	EUR 154

Gpr84 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6609104	ABM	1.0 ug DNA	EUR 154

GPR84 Protein Vector (Rat) (pPB-C-His)
PV271302	ABM	500 ng	EUR 603

GPR84 Protein Vector (Rat) (pPB-N-His)
PV271303	ABM	500 ng	EUR 603

GPR84 Rabbit Polyclonal Antibody