MGRN1 Rabbit Polyclonal Antibody

MGRN1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    MGRN1 Polyclonal Antibody

    ES11851-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MGRN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MGRN1 Polyclonal Antibody

    ES11851-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MGRN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MGRN1 antibody

    70R-18507 50 ul
    EUR 435
    Description: Rabbit polyclonal MGRN1 antibody

    MGRN1 antibody

    70R-2641 50 ug
    EUR 467
    Description: Rabbit polyclonal MGRN1 antibody raised against the middle region of MGRN1

    MGRN1 antibody

    10R-4812 100 ul
    EUR 726
    Description: Mouse monoclonal MGRN1 antibody

    MGRN1 antibody

    10R-4814 100 ul
    EUR 691
    Description: Mouse monoclonal MGRN1 antibody

    MGRN1 antibody

    10R-4816 100 ul
    EUR 691
    Description: Mouse monoclonal MGRN1 antibody

    MGRN1 antibody

    10R-4817 100 ul
    EUR 691
    Description: Mouse monoclonal MGRN1 antibody

    MGRN1 Antibody

    1-CSB-PA013790GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against MGRN1. Recognizes MGRN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    MGRN1 Antibody

    abx146080-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Mgrn1/ Rat Mgrn1 ELISA Kit

    ELI-36648r 96 Tests
    EUR 886

    Anti-MGRN1 antibody

    STJ193009 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to MGRN1

    MGRN1 siRNA

    20-abx903248
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MGRN1 siRNA

    20-abx924107
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MGRN1 siRNA

    20-abx924108
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MGRN1 Blocking Peptide

    33R-2492 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MGRN1 antibody, catalog no. 70R-2641

    MGRN1 cloning plasmid

    CSB-CL013790HU-10ug 10ug
    EUR 594
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1731
    • Sequence: atgggctccattctcagccgccgcatcgcgggggtggaggacatcgacatccaggcgaactcggcctatcgctaccctccgaagtccggaaactactttgcttcgcactttttcatgggaggagagaaattcgacaccccccaccctgaaggttacctctttggagagaacatgg
    • Show more
    Description: A cloning plasmid for the MGRN1 gene.

    pCMV-SPORT6-MGRN1

    PVT19130 2 ug
    EUR 231

    Human E3 ubiquitin- protein ligase MGRN1, MGRN1 ELISA KIT

    ELI-23419h 96 Tests
    EUR 824

    Mouse E3 ubiquitin- protein ligase MGRN1, Mgrn1 ELISA KIT

    ELI-42904m 96 Tests
    EUR 865

    Rat MGRN1 shRNA Plasmid

    20-abx989165
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human MGRN1 shRNA Plasmid

    20-abx958158
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse MGRN1 shRNA Plasmid

    20-abx971473
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    MGRN1 Recombinant Protein (Human)

    RP019432 100 ug Ask for price

    MGRN1 Recombinant Protein (Mouse)

    RP150560 100 ug Ask for price

    MGRN1 Recombinant Protein (Mouse)

    RP150557 100 ug Ask for price

    MGRN1 Recombinant Protein (Rat)

    RP211703 100 ug Ask for price

    Mahogunin, Ring Finger 1 (MGRN1) Antibody

    20-abx113582
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Monoclonal MGRN1 Antibody (monoclonal) (M07), Clone: 30

    AMM03796G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human MGRN1 (monoclonal) (M07). The antibodies are raised in mouse and are from clone 30. This antibody is applicable in WB and IF

    Mgrn1 ORF Vector (Rat) (pORF)

    ORF070569 1.0 ug DNA
    EUR 506

    MGRN1 ORF Vector (Human) (pORF)

    ORF006478 1.0 ug DNA
    EUR 95

    Mgrn1 ORF Vector (Mouse) (pORF)

    ORF050187 1.0 ug DNA
    EUR 506

    Mgrn1 ORF Vector (Mouse) (pORF)

    ORF050188 1.0 ug DNA
    EUR 506

    Mgrn1 sgRNA CRISPR Lentivector set (Rat)

    K7269901 3 x 1.0 ug
    EUR 339

    MGRN1 sgRNA CRISPR Lentivector set (Human)

    K1299501 3 x 1.0 ug
    EUR 339

    Mgrn1 sgRNA CRISPR Lentivector set (Mouse)

    K3879001 3 x 1.0 ug
    EUR 339

    Mgrn1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7269902 1.0 ug DNA
    EUR 154

    Mgrn1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7269903 1.0 ug DNA
    EUR 154

    Mgrn1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7269904 1.0 ug DNA
    EUR 154

    MGRN1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1299502 1.0 ug DNA
    EUR 154

    MGRN1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1299503 1.0 ug DNA
    EUR 154

    MGRN1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1299504 1.0 ug DNA
    EUR 154

    Mgrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3879002 1.0 ug DNA
    EUR 154

    Mgrn1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3879003 1.0 ug DNA
    EUR 154

    Mgrn1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3879004 1.0 ug DNA
    EUR 154

    MGRN1 Protein Vector (Mouse) (pPB-C-His)

    PV200746 500 ng
    EUR 1065

    MGRN1 Protein Vector (Mouse) (pPB-N-His)

    PV200747 500 ng
    EUR 1065

    MGRN1 Protein Vector (Mouse) (pPM-C-HA)

    PV200748 500 ng
    EUR 1065

    MGRN1 Protein Vector (Mouse) (pPM-C-His)

    PV200749 500 ng
    EUR 1065

    MGRN1 Protein Vector (Mouse) (pPB-C-His)

    PV200750 500 ng
    EUR 603

    MGRN1 Protein Vector (Mouse) (pPB-N-His)

    PV200751 500 ng
    EUR 603

    MGRN1 Protein Vector (Mouse) (pPM-C-HA)

    PV200752 500 ng
    EUR 603

    MGRN1 Protein Vector (Mouse) (pPM-C-His)

    PV200753 500 ng
    EUR 603

    MGRN1 Protein Vector (Rat) (pPB-C-His)

    PV282274 500 ng
    EUR 603

    MGRN1 Protein Vector (Rat) (pPB-N-His)

    PV282275 500 ng
    EUR 603

    MGRN1 Protein Vector (Rat) (pPM-C-HA)

    PV282276 500 ng
    EUR 603

    MGRN1 Protein Vector (Rat) (pPM-C-His)

    PV282277 500 ng
    EUR 603

    MGRN1 Protein Vector (Human) (pPB-C-His)

    PV025909 500 ng
    EUR 329

    MGRN1 Protein Vector (Human) (pPB-N-His)

    PV025910 500 ng
    EUR 329

    MGRN1 Protein Vector (Human) (pPM-C-HA)

    PV025911 500 ng
    EUR 329

    MGRN1 Protein Vector (Human) (pPM-C-His)

    PV025912 500 ng
    EUR 329

    Mgrn1 3'UTR Luciferase Stable Cell Line

    TU113181 1.0 ml Ask for price

    Mgrn1 3'UTR GFP Stable Cell Line

    TU163181 1.0 ml Ask for price

    Mgrn1 3'UTR Luciferase Stable Cell Line

    TU213173 1.0 ml Ask for price

    Mgrn1 3'UTR GFP Stable Cell Line

    TU263173 1.0 ml Ask for price

    MGRN1 3'UTR GFP Stable Cell Line

    TU063327 1.0 ml
    EUR 2333

    MGRN1 3'UTR Luciferase Stable Cell Line

    TU013327 1.0 ml
    EUR 2333

    MGRN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

    LV681007 1.0 ug DNA
    EUR 682

    MGRN1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

    LV681011 1.0 ug DNA
    EUR 682

    MGRN1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

    LV681012 1.0 ug DNA
    EUR 682

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    MGRN1 Rabbit Polyclonal Antibody