MVP Rabbit Polyclonal Antibody

MVP Rabbit Polyclonal Antibody

Contact Us Below To Order :

    MVP Polyclonal Antibody

    ABP59347-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human MVP protein
    • Applications tips:
    Description: A polyclonal antibody for detection of MVP from Human, Mouse, Rat. This MVP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MVP protein

    MVP Polyclonal Antibody

    ES11827-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MVP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MVP Polyclonal Antibody

    ES11827-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MVP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Human Major Vault Protein (MVP) ELISA Kit

    DLR-MVP-Hu-48T 48T
    EUR 517
    • Should the Human Major Vault Protein (MVP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Major Vault Protein (MVP) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Major Vault Protein (MVP) ELISA Kit

    DLR-MVP-Hu-96T 96T
    EUR 673
    • Should the Human Major Vault Protein (MVP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Major Vault Protein (MVP) in samples from serum, plasma, tissue homogenates or other biological fluids.

    Human Major Vault Protein (MVP) ELISA Kit

    RDR-MVP-Hu-48Tests 48 Tests
    EUR 544

    Human Major Vault Protein (MVP) ELISA Kit

    RDR-MVP-Hu-96Tests 96 Tests
    EUR 756

    Human Major Vault Protein (MVP) ELISA Kit

    RD-MVP-Hu-48Tests 48 Tests
    EUR 521

    Human Major Vault Protein (MVP) ELISA Kit

    RD-MVP-Hu-96Tests 96 Tests
    EUR 723

    MVP Rabbit pAb

    A1980-100ul 100 ul
    EUR 308

    MVP Rabbit pAb

    A1980-200ul 200 ul
    EUR 459

    MVP Rabbit pAb

    A1980-20ul 20 ul
    EUR 183

    MVP Rabbit pAb

    A1980-50ul 50 ul
    EUR 223

    Polyclonal MVP Antibody (N-term)

    APR08581G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MVP (N-term). This antibody is tested and proven to work in the following applications:

    MVP Polyclonal Antibody, HRP Conjugated

    A56484 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    MVP Polyclonal Antibody, FITC Conjugated

    A56485 100 µg
    EUR 570.55
    Description: fast delivery possible

    MVP Polyclonal Antibody, Biotin Conjugated

    A56486 100 µg
    EUR 570.55
    Description: reagents widely cited

    MVP antibody

    70R-18687 50 ul
    EUR 435
    Description: Rabbit polyclonal MVP antibody

    MVP antibody

    70R-13556 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal MVP antibody

    MVP antibody

    70R-2052 50 ug
    EUR 467
    Description: Rabbit polyclonal MVP antibody raised against the N terminal of MVP

    MVP Antibody

    32533-100ul 100ul
    EUR 252

    MVP Antibody

    49659-100ul 100ul
    EUR 333

    MVP Antibody

    49659-50ul 50ul
    EUR 239

    MVP Antibody

    49662-100ul 100ul
    EUR 333

    MVP Antibody

    49662-50ul 50ul
    EUR 239

    MVP Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

    MVP Antibody

    DF6732 200ul
    EUR 304
    Description: MVP Antibody detects endogenous levels of total MVP.

    MVP Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    MVP Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000

    MVP Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

    MVP Antibody

    ABD6732 100 ug
    EUR 438

    Rabbit MVP ELISA Kit

    ERTM0362 96Tests
    EUR 521

    Polyclonal MVP / VAULT1 Antibody (aa878-893)

    APR02315G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MVP / VAULT1 (aa878-893). This antibody is tested and proven to work in the following applications:

    Major vault protein (MVP) polyclonal antibody

    ABP-PAB-10900 100 ug Ask for price
      • Product line: Miscellaneous
      • Brand:

    LRP(MVP) antibody

    22901-100ul 100ul
    EUR 390

    Anti-MVP Antibody

    A00642-1 100ug/vial
    EUR 334

    MVP Conjugated Antibody

    C49659 100ul
    EUR 397

    MVP Conjugated Antibody

    C32533 100ul
    EUR 397

    MVP / LRP Antibody

    abx235449-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Anti-MVP antibody

    STJ24649 100 µl
    EUR 277
    Description: This gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The encoded protein may play a role in multiple cellular processes by regulating the MAP kinase, JAK/STAT and phosphoinositide 3-kinase/Akt signaling pathways. The encoded protein also plays a role in multidrug resistance, and expression of this gene may be a prognostic marker for several types of cancer. Alternatively spliced transcript variants have been observed for this gene.

    Anti-MVP antibody

    STJ192985 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to MVP

    Mvp/ Rat Mvp ELISA Kit

    ELI-03488r 96 Tests
    EUR 886

    Major Vault Protein (MVP) Polyclonal Antibody (Human)

    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MVP (Ala2~Pro272)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP)

    MVP siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MVP siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MVP Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    MVP Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    MVP Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    MVP recombinant monoclonal antibody

    A5824 100ul X 3
    EUR 595
    • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
    • Show more
    Description: A recombinant monoclonal antibody from rabbit against human MVP for WB,ELISA

    anti- MVP/LRP antibody

    FNab05449 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500 - 1:2000
    • IHC: 1:50 - 1:200
    • IF: 1:50 - 1:100
    • Immunogen: major vault protein
    • Uniprot ID: Q14764
    • Gene ID: 9961
    • Research Area: Cancer, Metabolism
    Description: Antibody raised against MVP/LRP

    Anti-MVP/LRP antibody

    PAab05449 100 ug
    EUR 355

    Anti-LRP/MVP antibody

    STJ16100893 1 mL
    EUR 478

    Anti-LRP/MVP antibody

    STJ16100902 1 mL
    EUR 478

    Anti-MVP/LRP antibody

    STJ16100910 100 µg
    EUR 354

    Anti-MVP/LRP antibody

    STJ16100911 100 µg
    EUR 354

    Anti-MVP/LRP antibody

    STJ16100912 100 µg
    EUR 354

    Major Vault Protein (MVP) Polyclonal Antibody (Human), APC

    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MVP (Ala2~Pro272)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with APC.

    Major Vault Protein (MVP) Polyclonal Antibody (Human), Biotinylated

    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MVP (Ala2~Pro272)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with Biotin.

    Major Vault Protein (MVP) Polyclonal Antibody (Human), Cy3

    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MVP (Ala2~Pro272)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with Cy3.

    Major Vault Protein (MVP) Polyclonal Antibody (Human), FITC

    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MVP (Ala2~Pro272)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with FITC.

    Major Vault Protein (MVP) Polyclonal Antibody (Human), HRP

    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MVP (Ala2~Pro272)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with HRP.

    Major Vault Protein (MVP) Polyclonal Antibody (Human), PE

    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MVP (Ala2~Pro272)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with PE.

    Rabbit Major Vault Protein (MVP) ELISA Kit

    abx362163-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Major Vault Protein (MVP) Antibody

    abx025511-100ul 100 ul
    EUR 523
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Major Vault Protein (MVP) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    • EUR 815.00
    • EUR 425.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Major Vault Protein (MVP) Antibody

    abx032736-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    abx032736-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    abx033927-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    abx033927-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    • EUR 370.00
    • EUR 606.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anti-MVP Antibody (monoclonal, 8B12)

    M00642-1 100ug/vial
    EUR 334

    Major Vault Protein (MVP) Polyclonal Antibody (Human), APC-Cy7

    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: MVP (Ala2~Pro272)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with APC-Cy7.

    MVP Blocking Peptide

    33R-5769 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MVP antibody, catalog no. 70R-2052

    MVP Blocking Peptide

    DF6732-BP 1mg
    EUR 195

    MVP cloning plasmid

    CSB-CL015248HU-10ug 10ug
    EUR 558
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2682
    • Sequence: atggcaactgaagagttcatcatccgcatccccccataccactatatccatgtgctggaccagaacagcaacgtgtcccgtgtggaggtcgggccaaagacctacatccggcaggacaatgagagggtactgtttgcccccatgcgcatggtgaccgtccccccacgtcactact
    • Show more
    Description: A cloning plasmid for the MVP gene.

    Major Vault Protein (MVP) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Major Vault Protein (MVP) (VP2897R) Antibody

    BNCR2897-250 250uL
    EUR 394
    Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), RPE conjugate, Concentration: 0.1mg/mL

    Major Vault Protein (MVP)(1014) Antibody

    BNUB0224-100 100uL
    EUR 209
    Description: Primary antibody against Major Vault Protein (MVP)(1014), Concentration: 0.2mg/mL

    Major Vault Protein (MVP)(1014) Antibody

    BNUB0224-500 500uL
    EUR 458
    Description: Primary antibody against Major Vault Protein (MVP)(1014), Concentration: 0.2mg/mL

    Major Vault Protein (MVP)(1032) Antibody

    BNUB0225-100 100uL
    EUR 209
    Description: Primary antibody against Major Vault Protein (MVP)(1032), Concentration: 0.2mg/mL

    Major Vault Protein (MVP)(1032) Antibody

    BNUB0225-500 500uL
    EUR 458
    Description: Primary antibody against Major Vault Protein (MVP)(1032), Concentration: 0.2mg/mL

    Major Vault Protein (MVP) (VP2897R) Antibody

    BNUB2897-100 100uL
    EUR 264
    Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Concentration: 0.2mg/mL

    Major Vault Protein (MVP) (VP2897R) Antibody

    BNUB2897-50 50uL
    EUR 405
    Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), 1mg/mL

    Major Vault Protein (MVP) (VP2897R) Antibody

    BNUB2897-500 500uL
    EUR 513
    Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Concentration: 0.2mg/mL

    Major Vault Protein (MVP)(1014) Antibody

    BNUM0224-50 50uL
    EUR 395
    Description: Primary antibody against Major Vault Protein (MVP)(1014), 1mg/mL

    Major Vault Protein (MVP)(1032) Antibody

    BNUM0225-50 50uL
    EUR 395
    Description: Primary antibody against Major Vault Protein (MVP)(1032), 1mg/mL

    Major Vault Protein (MVP)(1014) Antibody

    BNC040224-100 100uL
    EUR 199
    Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405S conjugate, Concentration: 0.1mg/mL

    Major Vault Protein (MVP)(1014) Antibody

    BNC040224-500 500uL
    EUR 544
    Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405S conjugate, Concentration: 0.1mg/mL

    Major Vault Protein (MVP)(1032) Antibody

    BNC040225-100 100uL
    EUR 199
    Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405S conjugate, Concentration: 0.1mg/mL

    MVP Rabbit Polyclonal Antibody