MVP Rabbit Polyclonal Antibody

MVP Rabbit Polyclonal Antibody

Contact Us Below To Order :

MVP Polyclonal Antibody
ABP59347-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MVP protein Applications tips:
Description: A polyclonal antibody for detection of MVP from Human, Mouse, Rat. This MVP antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MVP protein

MVP Polyclonal Antibody
ES11827-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MVP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

MVP Polyclonal Antibody
ES11827-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MVP from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Major Vault Protein (MVP) ELISA Kit
DLR-MVP-Hu-48T	DL Develop	48T	EUR 517
Should the Human Major Vault Protein (MVP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Major Vault Protein (MVP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Major Vault Protein (MVP) ELISA Kit
DLR-MVP-Hu-96T	DL Develop	96T	EUR 673
Should the Human Major Vault Protein (MVP) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Major Vault Protein (MVP) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Major Vault Protein (MVP) ELISA Kit
RDR-MVP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Major Vault Protein (MVP) ELISA Kit
RDR-MVP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Major Vault Protein (MVP) ELISA Kit
RD-MVP-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Major Vault Protein (MVP) ELISA Kit
RD-MVP-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

MVP Rabbit pAb
A1980-100ul	Abclonal	100 ul	EUR 308

MVP Rabbit pAb
A1980-200ul	Abclonal	200 ul	EUR 459

MVP Rabbit pAb
A1980-20ul	Abclonal	20 ul	EUR 183

MVP Rabbit pAb
A1980-50ul	Abclonal	50 ul	EUR 223

Polyclonal MVP Antibody (N-term)
APR08581G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MVP (N-term). This antibody is tested and proven to work in the following applications:

MVP Polyclonal Antibody, HRP Conjugated
A56484	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

MVP Polyclonal Antibody, FITC Conjugated
A56485	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

MVP Polyclonal Antibody, Biotin Conjugated
A56486	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

Rabbit MVP ELISA Kit
ERTM0362	Abclonal	96Tests	EUR 521

MVP antibody
70R-18687	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MVP antibody

MVP antibody
70R-13556	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal MVP antibody

MVP antibody
70R-2052	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MVP antibody raised against the N terminal of MVP

MVP Antibody
32533-100ul	SAB	100ul	EUR 252

MVP Antibody
49659-100ul	SAB	100ul	EUR 333

MVP Antibody
49659-50ul	SAB	50ul	EUR 239

MVP Antibody
49662-100ul	SAB	100ul	EUR 333

MVP Antibody
49662-50ul	SAB	50ul	EUR 239

MVP Antibody
1-CSB-PA110757	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200

MVP Antibody
DF6732	Affbiotech	200ul	EUR 304
Description: MVP Antibody detects endogenous levels of total MVP.

MVP Antibody
1-CSB-PA015248GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

MVP Antibody
1-CSB-PA015248LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:200-1:1000

MVP Antibody
1-CSB-PA018595	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MVP. Recognizes MVP from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

MVP Antibody
ABD6732	Lifescience Market	100 ug	EUR 438

Polyclonal MVP / VAULT1 Antibody (aa878-893)
APR02315G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MVP / VAULT1 (aa878-893). This antibody is tested and proven to work in the following applications:

Major vault protein (MVP) polyclonal antibody
ABP-PAB-10900	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

LRP(MVP) antibody
22901-100ul	SAB	100ul	EUR 390

Anti-MVP Antibody
A00642-1	BosterBio	100ug/vial	EUR 334

MVP Conjugated Antibody
C49659	SAB	100ul	EUR 397

MVP Conjugated Antibody
C32533	SAB	100ul	EUR 397

MVP / LRP Antibody
abx235449-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Anti-MVP antibody
STJ24649	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The encoded protein may play a role in multiple cellular processes by regulating the MAP kinase, JAK/STAT and phosphoinositide 3-kinase/Akt signaling pathways. The encoded protein also plays a role in multidrug resistance, and expression of this gene may be a prognostic marker for several types of cancer. Alternatively spliced transcript variants have been observed for this gene.

Anti-MVP antibody
STJ192985	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MVP

Mvp/ Rat Mvp ELISA Kit
ELI-03488r	Lifescience Market	96 Tests	EUR 886

Major Vault Protein (MVP) Polyclonal Antibody (Human)
4-PAB764Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MVP (Ala2~Pro272) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP)

MVP siRNA
20-abx925067	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MVP siRNA
20-abx925068	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MVP Antibody, HRP conjugated
1-CSB-PA015248LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

MVP Antibody, FITC conjugated
1-CSB-PA015248LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

MVP Antibody, Biotin conjugated
1-CSB-PA015248LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against MVP. Recognizes MVP from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

MVP recombinant monoclonal antibody
A5824	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human MVP for WB,ELISA

anti- MVP/LRP antibody
FNab05449	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:100 Immunogen: major vault protein Uniprot ID: Q14764 Gene ID: 9961 Research Area: Cancer, Metabolism
Description: Antibody raised against MVP/LRP

Anti-MVP/LRP antibody
PAab05449	Lifescience Market	100 ug	EUR 355

Anti-LRP/MVP antibody
STJ16100893	St John's Laboratory	1 mL	EUR 478

Anti-LRP/MVP antibody
STJ16100902	St John's Laboratory	1 mL	EUR 478

Anti-MVP/LRP antibody
STJ16100910	St John's Laboratory	100 µg	EUR 354

Anti-MVP/LRP antibody
STJ16100911	St John's Laboratory	100 µg	EUR 354

Anti-MVP/LRP antibody
STJ16100912	St John's Laboratory	100 µg	EUR 354

Major Vault Protein (MVP) Polyclonal Antibody (Human), APC
4-PAB764Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MVP (Ala2~Pro272) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with APC.

Major Vault Protein (MVP) Polyclonal Antibody (Human), Biotinylated
4-PAB764Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MVP (Ala2~Pro272) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with Biotin.

Major Vault Protein (MVP) Polyclonal Antibody (Human), Cy3
4-PAB764Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MVP (Ala2~Pro272) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with Cy3.

Major Vault Protein (MVP) Polyclonal Antibody (Human), FITC
4-PAB764Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MVP (Ala2~Pro272) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with FITC.

Major Vault Protein (MVP) Polyclonal Antibody (Human), HRP
4-PAB764Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MVP (Ala2~Pro272) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with HRP.

Major Vault Protein (MVP) Polyclonal Antibody (Human), PE
4-PAB764Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MVP (Ala2~Pro272) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with PE.

Rabbit Major Vault Protein (MVP) ELISA Kit
abx362163-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Major Vault Protein (MVP) Antibody
abx025511-100ul	Abbexa	100 ul	EUR 523
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
20-abx113585	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
20-abx129080	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Major Vault Protein (MVP) Antibody
20-abx109322	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
20-abx173444	Abbexa	EUR 815.00 EUR 425.00	1 mg 200 ug
Please enquire.

Major Vault Protein (MVP) Antibody
abx032736-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
abx032736-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
abx033927-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
abx033927-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
20-abx241893	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
20-abx242151	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
20-abx225299	Abbexa	EUR 370.00 EUR 606.00 EUR 314.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody
20-abx001613	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Anti-MVP Antibody (monoclonal, 8B12)
M00642-1	BosterBio	100ug/vial	EUR 334

MVP Blocking Peptide
33R-5769	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MVP antibody, catalog no. 70R-2052

MVP Blocking Peptide
DF6732-BP	Affbiotech	1mg	EUR 195

MVP cloning plasmid
CSB-CL015248HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2682 Sequence: atggcaactgaagagttcatcatccgcatccccccataccactatatccatgtgctggaccagaacagcaacgtgtcccgtgtggaggtcgggccaaagacctacatccggcaggacaatgagagggtactgtttgcccccatgcgcatggtgaccgtccccccacgtcactact Show more
Description: A cloning plasmid for the MVP gene.

Major Vault Protein (MVP) Polyclonal Antibody (Human), APC-Cy7
4-PAB764Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MVP (Ala2~Pro272) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Major Vault Protein (MVP). This antibody is labeled with APC-Cy7.

Major Vault Protein (MVP) Antibody (Biotin)
20-abx105646	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody (FITC)
20-abx107063	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Vault Protein (MVP) Antibody (HRP)
20-abx108484	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Major Vault Protein (MVP) (VP2897R) Antibody
BNCR2897-250	Biotium	250uL	EUR 394
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), RPE conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody
BNUB0224-100	Biotium	100uL	EUR 209
Description: Primary antibody against Major Vault Protein (MVP)(1014), Concentration: 0.2mg/mL

Major Vault Protein (MVP)(1014) Antibody
BNUB0224-500	Biotium	500uL	EUR 458
Description: Primary antibody against Major Vault Protein (MVP)(1014), Concentration: 0.2mg/mL

Major Vault Protein (MVP)(1032) Antibody
BNUB0225-100	Biotium	100uL	EUR 209
Description: Primary antibody against Major Vault Protein (MVP)(1032), Concentration: 0.2mg/mL

Major Vault Protein (MVP)(1032) Antibody
BNUB0225-500	Biotium	500uL	EUR 458
Description: Primary antibody against Major Vault Protein (MVP)(1032), Concentration: 0.2mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody
BNUB2897-100	Biotium	100uL	EUR 264
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Concentration: 0.2mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody
BNUB2897-50	Biotium	50uL	EUR 405
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), 1mg/mL

Major Vault Protein (MVP) (VP2897R) Antibody
BNUB2897-500	Biotium	500uL	EUR 513
Description: Primary antibody against Major Vault Protein (MVP) (VP2897R), Concentration: 0.2mg/mL

Major Vault Protein (MVP)(1014) Antibody
BNUM0224-50	Biotium	50uL	EUR 395
Description: Primary antibody against Major Vault Protein (MVP)(1014), 1mg/mL

Major Vault Protein (MVP)(1032) Antibody
BNUM0225-50	Biotium	50uL	EUR 395
Description: Primary antibody against Major Vault Protein (MVP)(1032), 1mg/mL

Major Vault Protein (MVP)(1014) Antibody
BNC040224-100	Biotium	100uL	EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405S conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1014) Antibody
BNC040224-500	Biotium	500uL	EUR 544
Description: Primary antibody against Major Vault Protein (MVP)(1014), CF405S conjugate, Concentration: 0.1mg/mL

Major Vault Protein (MVP)(1032) Antibody
BNC040225-100	Biotium	100uL	EUR 199
Description: Primary antibody against Major Vault Protein (MVP)(1032), CF405S conjugate, Concentration: 0.1mg/mL

MVP Rabbit Polyclonal Antibody