DVL1 Rabbit Polyclonal Antibody

DVL1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DVL1 Polyclonal Antibody

    ES11836-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against DVL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DVL1 Rabbit pAb

    A10536-100ul 100 ul
    EUR 308

    DVL1 Rabbit pAb

    A10536-200ul 200 ul
    EUR 459

    DVL1 Rabbit pAb

    A10536-20ul 20 ul
    EUR 183

    DVL1 Rabbit pAb

    A10536-50ul 50 ul
    EUR 223

    Polyclonal DVL1 Antibody (Center)

    APC00112G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications:

    Polyclonal DVL1 Antibody (Center)

    AMM06980G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications:

    DVL1 antibody

    70R-1638 100 ug
    EUR 377
    Description: Rabbit polyclonal DVL1 antibody

    DVL1 antibody

    70R-1639 100 ug
    EUR 377
    Description: Rabbit polyclonal DVL1 antibody

    DVL1 Antibody

    43257-100ul 100ul
    EUR 252

    DVL1 Antibody

    DF7515 200ul
    EUR 304
    Description: DVL1 Antibody detects endogenous levels of total DVL1.

    DVL1 Antibody

    ABD7515 100 ug
    EUR 438

    DVL1 antibody

    PAab09841 100 ug
    EUR 386

    DVL1 Conjugated Antibody

    C43257 100ul
    EUR 397

    anti- DVL1 antibody

    FNab09841 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:2000
    • IHC: 1:50-1:500
    • Immunogen: dishevelled, dsh homolog 1
    • Uniprot ID: O14640
    • Gene ID: 1855
    • Research Area: Neuroscience, Signal Transduction, Developmental biology
    Description: Antibody raised against DVL1

    anti- DVL1 antibody

    LSMab09841 100 ug
    EUR 386

    Anti-DVL1 antibody

    STJ116411 100 µl
    EUR 277
    Description: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.

    Anti-DVL1 antibody

    STJ192994 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DVL1

    DVL1 siRNA

    20-abx901607
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DVL1 siRNA

    20-abx914783
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DVL1 siRNA

    20-abx914784
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-DVL1

    YF-PA27212 50 ug
    EUR 363
    Description: Mouse polyclonal to DVL1

    Polyclonal DVL1 / DVL / Dishevelled Antibody (aa20-32)

    APC00111G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DVL1 / DVL / Dishevelled (aa20-32). This antibody is tested and proven to work in the following applications:

    Anti-Dishevelled/Dvl1 Antibody

    A03533-1 100ug/vial
    EUR 334

    Anti-Dvl1 (mouse) antibody

    STJ72776 100 µg
    EUR 359

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human)

    4-PAJ540Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1)

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse)

    4-PAJ540Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1)

    DVL1 Blocking Peptide

    33R-5088 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DVL1 antibody, catalog no. 70R-1638

    DVL1 Blocking Peptide

    33R-1019 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACADM antibody, catalog no. 70R-2483

    DVL1 Blocking Peptide

    DF7515-BP 1mg
    EUR 195

    DVL1 cloning plasmid

    CSB-CL007284HU-10ug 10ug
    EUR 483
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1335
    • Sequence: atggcggagaccaagattatctaccacatggacgaggaggagacgccgtacctggtcaagctgcccgtggcccccgagcgcgtcacgctggccgacttcaagaacgtgctcagcaaccggcccgtgcacgcctacaaattcttctttaagtccatggaccaggacttcggggtgg
    • Show more
    Description: A cloning plasmid for the DVL1 gene.

    anti-Dishevelled / Dvl1

    YF-PA11452 50 ul
    EUR 363
    Description: Mouse polyclonal to Dishevelled / Dvl1

    anti-Dishevelled / Dvl1

    YF-PA11453 100 ug
    EUR 403
    Description: Rabbit polyclonal to Dishevelled / Dvl1

    anti-Dishevelled / Dvl1

    YF-PA23616 50 ul
    EUR 334
    Description: Mouse polyclonal to Dishevelled / Dvl1

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC

    4-PAJ540Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Biotinylated

    4-PAJ540Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Cy3

    4-PAJ540Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), FITC

    4-PAJ540Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), HRP

    4-PAJ540Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), PE

    4-PAJ540Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC

    4-PAJ540Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Biotinylated

    4-PAJ540Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Cy3

    4-PAJ540Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), FITC

    4-PAJ540Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), HRP

    4-PAJ540Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), PE

    4-PAJ540Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE.

    Human DVL1 ELISA Kit

    ELA-E15104h 96 Tests
    EUR 824

    DVL1 ELISA KIT|Human

    EF005905 96 Tests
    EUR 689

    Rat DVL1 shRNA Plasmid

    20-abx986842
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse DVL1 shRNA Plasmid

    20-abx970078
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human DVL1 shRNA Plasmid

    20-abx951301
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    DVL1 Recombinant Protein (Human)

    RP009988 100 ug Ask for price

    DVL1 Recombinant Protein (Rat)

    RP198854 100 ug Ask for price

    DVL1 Recombinant Protein (Mouse)

    RP130349 100 ug Ask for price

    Dishevelled, Dsh Homolog 1 (DVL1) Antibody

    20-abx102614
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Dishevelled, Dsh Homolog 1 (DVL1) Antibody

    20-abx102615
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC-Cy7

    4-PAJ540Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC-Cy7

    4-PAJ540Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7.

    Dvl1 ORF Vector (Rat) (pORF)

    ORF066286 1.0 ug DNA
    EUR 506

    DVL1 ORF Vector (Human) (pORF)

    ORF003330 1.0 ug DNA
    EUR 95

    Dvl1 ORF Vector (Mouse) (pORF)

    ORF043451 1.0 ug DNA
    EUR 506

    DVL1 ELISA Kit (Human) (OKEH02504)

    OKEH02504 96 Wells
    EUR 779
    Description: Description of target: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.021 ng/mL

    DVL1 sgRNA CRISPR Lentivector set (Human)

    K0642301 3 x 1.0 ug
    EUR 339

    Dvl1 sgRNA CRISPR Lentivector set (Rat)

    K6997701 3 x 1.0 ug
    EUR 339

    Dvl1 sgRNA CRISPR Lentivector set (Mouse)

    K3976501 3 x 1.0 ug
    EUR 339

    Recombinant Dishevelled, Dsh Homolog 1 (DVL1)

    4-RPJ540Hu01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: O14640
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 19.0kDa
    • Isoelectric Point: 11.1
    Description: Recombinant Human Dishevelled, Dsh Homolog 1 expressed in: E.coli

    Recombinant Dishevelled, Dsh Homolog 1 (DVL1)

    4-RPJ540Mu01
    • EUR 512.16
    • EUR 240.00
    • EUR 1645.60
    • EUR 615.20
    • EUR 1130.40
    • EUR 406.00
    • EUR 3964.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P51141
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 24.0kDa
    • Isoelectric Point: 8.1
    Description: Recombinant Mouse Dishevelled, Dsh Homolog 1 expressed in: E.coli

    Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody

    abx026731-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody

    abx026731-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Segment Polarity Protein Dishevelled Homolog DVL-1 (Dvl1) Antibody

    abx431219-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Mouse Dishevelled, Dsh Homolog 1 (DVL1) Protein

    20-abx066347
    • EUR 718.00
    • EUR 286.00
    • EUR 2221.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Dishevelled, Dsh Homolog 1 (DVL1) Protein

    20-abx066348
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    DVL1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0642302 1.0 ug DNA
    EUR 154

    DVL1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0642303 1.0 ug DNA
    EUR 154

    DVL1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0642304 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6997702 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6997703 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6997704 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3976502 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3976503 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3976504 1.0 ug DNA
    EUR 154

    DVL1 Protein Vector (Mouse) (pPB-C-His)

    PV173802 500 ng
    EUR 1065

    DVL1 Protein Vector (Mouse) (pPB-N-His)

    PV173803 500 ng
    EUR 1065

    DVL1 Protein Vector (Mouse) (pPM-C-HA)

    PV173804 500 ng
    EUR 1065

    DVL1 Protein Vector (Mouse) (pPM-C-His)

    PV173805 500 ng
    EUR 1065

    DVL1 Protein Vector (Rat) (pPB-C-His)

    PV265142 500 ng
    EUR 1166

    DVL1 Protein Vector (Rat) (pPB-N-His)

    PV265143 500 ng
    EUR 1166

    DVL1 Protein Vector (Rat) (pPM-C-HA)

    PV265144 500 ng
    EUR 1166

    DVL1 Protein Vector (Rat) (pPM-C-His)

    PV265145 500 ng
    EUR 1166

    DVL1 Protein Vector (Human) (pPB-C-His)

    PV013317 500 ng
    EUR 329

    DVL1 Protein Vector (Human) (pPB-N-His)

    PV013318 500 ng
    EUR 329

    DVL1 Protein Vector (Human) (pPM-C-HA)

    PV013319 500 ng
    EUR 329

    DVL1 Protein Vector (Human) (pPM-C-His)

    PV013320 500 ng
    EUR 329

    Dvl1 3'UTR GFP Stable Cell Line

    TU155471 1.0 ml Ask for price

    Dvl1 3'UTR Luciferase Stable Cell Line

    TU105471 1.0 ml Ask for price

    Dvl1 3'UTR Luciferase Stable Cell Line

    TU203704 1.0 ml Ask for price

    DVL1 Rabbit Polyclonal Antibody