DVL1 Rabbit Polyclonal Antibody

DVL1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

DVL1 Polyclonal Antibody
ES11836-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against DVL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal DVL1 Antibody (Center)
APC00112G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal DVL1 Antibody (Center)
AMM06980G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications:

DVL1 Rabbit pAb
A10536-100ul	Abclonal	100 ul	EUR 308

DVL1 Rabbit pAb
A10536-200ul	Abclonal	200 ul	EUR 459

DVL1 Rabbit pAb
A10536-20ul	Abclonal	20 ul	EUR 183

DVL1 Rabbit pAb
A10536-50ul	Abclonal	50 ul	EUR 223

DVL1 antibody
70R-1638	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal DVL1 antibody

DVL1 antibody
70R-1639	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal DVL1 antibody

DVL1 Antibody
43257-100ul	SAB	100ul	EUR 252

DVL1 Antibody
DF7515	Affbiotech	200ul	EUR 304
Description: DVL1 Antibody detects endogenous levels of total DVL1.

DVL1 Antibody
ABD7515	Lifescience Market	100 ug	EUR 438

DVL1 antibody
PAab09841	Lifescience Market	100 ug	EUR 386

DVL1 Conjugated Antibody
C43257	SAB	100ul	EUR 397

anti- DVL1 antibody
FNab09841	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:2000 IHC: 1:50-1:500 Immunogen: dishevelled, dsh homolog 1 Uniprot ID: O14640 Gene ID: 1855 Research Area: Neuroscience, Signal Transduction, Developmental biology
Description: Antibody raised against DVL1

anti- DVL1 antibody
LSMab09841	Lifescience Market	100 ug	EUR 386

Anti-DVL1 antibody
STJ116411	St John's Laboratory	100 µl	EUR 277
Description: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.

Anti-DVL1 antibody
STJ192994	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to DVL1

Polyclonal DVL1 / DVL / Dishevelled Antibody (aa20-32)
APC00111G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DVL1 / DVL / Dishevelled (aa20-32). This antibody is tested and proven to work in the following applications:

DVL1 siRNA
20-abx901607	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DVL1 siRNA
20-abx914783	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DVL1 siRNA
20-abx914784	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-DVL1
YF-PA27212	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to DVL1

Anti-Dishevelled/Dvl1 Antibody
A03533-1	BosterBio	100ug/vial	EUR 334

Anti-Dvl1 (mouse) antibody
STJ72776	St John's Laboratory	100 µg	EUR 359

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human)
4-PAJ540Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Lys285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1)

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse)
4-PAJ540Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Ser332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1)

DVL1 Blocking Peptide
33R-5088	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DVL1 antibody, catalog no. 70R-1638

DVL1 Blocking Peptide
33R-1019	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACADM antibody, catalog no. 70R-2483

DVL1 Blocking Peptide
DF7515-BP	Affbiotech	1mg	EUR 195

DVL1 cloning plasmid
CSB-CL007284HU-10ug	Cusabio	10ug	EUR 483
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1335 Sequence: atggcggagaccaagattatctaccacatggacgaggaggagacgccgtacctggtcaagctgcccgtggcccccgagcgcgtcacgctggccgacttcaagaacgtgctcagcaaccggcccgtgcacgcctacaaattcttctttaagtccatggaccaggacttcggggtgg Show more
Description: A cloning plasmid for the DVL1 gene.

anti-Dishevelled / Dvl1
YF-PA11452	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to Dishevelled / Dvl1

anti-Dishevelled / Dvl1
YF-PA11453	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Dishevelled / Dvl1

anti-Dishevelled / Dvl1
YF-PA23616	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to Dishevelled / Dvl1

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC
4-PAJ540Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Lys285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Biotinylated
4-PAJ540Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Lys285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Cy3
4-PAJ540Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Lys285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), FITC
4-PAJ540Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Lys285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), HRP
4-PAJ540Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Lys285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), PE
4-PAJ540Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Lys285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC
4-PAJ540Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Ser332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Biotinylated
4-PAJ540Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Ser332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Cy3
4-PAJ540Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Ser332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), FITC
4-PAJ540Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Ser332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), HRP
4-PAJ540Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Ser332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), PE
4-PAJ540Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Ser332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE.

Dishevelled, Dsh Homolog 1 (DVL1) Antibody
20-abx102614	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dishevelled, Dsh Homolog 1 (DVL1) Antibody
20-abx102615	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC-Cy7
4-PAJ540Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Lys285) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7.

Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAJ540Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DVL1 (Arg150~Ser332) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7.

Human DVL1 ELISA Kit
ELA-E15104h	Lifescience Market	96 Tests	EUR 824

DVL1 ELISA KIT|Human
EF005905	Lifescience Market	96 Tests	EUR 689

Rat DVL1 shRNA Plasmid
20-abx986842	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse DVL1 shRNA Plasmid
20-abx970078	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human DVL1 shRNA Plasmid
20-abx951301	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DVL1 Recombinant Protein (Human)
RP009988	ABM	100 ug	Ask for price

DVL1 Recombinant Protein (Rat)
RP198854	ABM	100 ug	Ask for price

DVL1 Recombinant Protein (Mouse)
RP130349	ABM	100 ug	Ask for price

Dvl1 ORF Vector (Rat) (pORF)
ORF066286	ABM	1.0 ug DNA	EUR 506

DVL1 ORF Vector (Human) (pORF)
ORF003330	ABM	1.0 ug DNA	EUR 95

Dvl1 ORF Vector (Mouse) (pORF)
ORF043451	ABM	1.0 ug DNA	EUR 506

DVL1 ELISA Kit (Human) (OKEH02504)
OKEH02504	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.021 ng/mL

DVL1 sgRNA CRISPR Lentivector set (Human)
K0642301	ABM	3 x 1.0 ug	EUR 339

Dvl1 sgRNA CRISPR Lentivector set (Rat)
K6997701	ABM	3 x 1.0 ug	EUR 339

Dvl1 sgRNA CRISPR Lentivector set (Mouse)
K3976501	ABM	3 x 1.0 ug	EUR 339

Recombinant Dishevelled, Dsh Homolog 1 (DVL1)
4-RPJ540Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O14640 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.0kDa Isoelectric Point: 11.1
Description: Recombinant Human Dishevelled, Dsh Homolog 1 expressed in: E.coli

Recombinant Dishevelled, Dsh Homolog 1 (DVL1)
4-RPJ540Mu01	Cloud-Clone	EUR 512.16 EUR 240.00 EUR 1645.60 EUR 615.20 EUR 1130.40 EUR 406.00 EUR 3964.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P51141 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.0kDa Isoelectric Point: 8.1
Description: Recombinant Mouse Dishevelled, Dsh Homolog 1 expressed in: E.coli

Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody
abx026731-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody
abx026731-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Segment Polarity Protein Dishevelled Homolog DVL-1 (Dvl1) Antibody
abx431219-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Mouse Dishevelled, Dsh Homolog 1 (DVL1) Protein
20-abx066347	Abbexa	EUR 718.00 EUR 286.00 EUR 2221.00 EUR 857.00 EUR 509.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Dishevelled, Dsh Homolog 1 (DVL1) Protein
20-abx066348	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

DVL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0642302	ABM	1.0 ug DNA	EUR 154

DVL1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0642303	ABM	1.0 ug DNA	EUR 154

DVL1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0642304	ABM	1.0 ug DNA	EUR 154

Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6997702	ABM	1.0 ug DNA	EUR 154

Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6997703	ABM	1.0 ug DNA	EUR 154

Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6997704	ABM	1.0 ug DNA	EUR 154

Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3976502	ABM	1.0 ug DNA	EUR 154

Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3976503	ABM	1.0 ug DNA	EUR 154

Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3976504	ABM	1.0 ug DNA	EUR 154

DVL1 3'UTR Luciferase Stable Cell Line
TU006444	ABM	1.0 ml	EUR 1394

Dvl1 3'UTR GFP Stable Cell Line
TU155471	ABM	1.0 ml	Ask for price

Dvl1 3'UTR Luciferase Stable Cell Line
TU105471	ABM	1.0 ml	Ask for price

Dvl1 3'UTR Luciferase Stable Cell Line
TU203704	ABM	1.0 ml	Ask for price

Dvl1 3'UTR GFP Stable Cell Line
TU253704	ABM	1.0 ml	Ask for price

DVL1 3'UTR GFP Stable Cell Line
TU056444	ABM	1.0 ml	EUR 1394

DVL1 Protein Vector (Mouse) (pPB-C-His)
PV173802	ABM	500 ng	EUR 1065

DVL1 Protein Vector (Mouse) (pPB-N-His)
PV173803	ABM	500 ng	EUR 1065

DVL1 Protein Vector (Mouse) (pPM-C-HA)
PV173804	ABM	500 ng	EUR 1065

DVL1 Protein Vector (Mouse) (pPM-C-His)
PV173805	ABM	500 ng	EUR 1065

DVL1 Protein Vector (Rat) (pPB-C-His)
PV265142	ABM	500 ng	EUR 1166

DVL1 Protein Vector (Rat) (pPB-N-His)
PV265143	ABM	500 ng	EUR 1166

DVL1 Protein Vector (Rat) (pPM-C-HA)
PV265144	ABM	500 ng	EUR 1166

DVL1 Protein Vector (Rat) (pPM-C-His)
PV265145	ABM	500 ng	EUR 1166

DVL1 Protein Vector (Human) (pPB-C-His)
PV013317	ABM	500 ng	EUR 329

DVL1 Rabbit Polyclonal Antibody