DVL1 Rabbit Polyclonal Antibody

DVL1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DVL1 Polyclonal Antibody

    ES11836-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against DVL1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DVL1 Rabbit pAb

    A10536-100ul 100 ul
    EUR 308

    DVL1 Rabbit pAb

    A10536-200ul 200 ul
    EUR 459

    DVL1 Rabbit pAb

    A10536-20ul 20 ul
    EUR 183

    DVL1 Rabbit pAb

    A10536-50ul 50 ul
    EUR 223

    Polyclonal DVL1 Antibody (Center)

    APC00112G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications:

    Polyclonal DVL1 Antibody (Center)

    AMM06980G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DVL1 (Center). This antibody is tested and proven to work in the following applications:

    DVL1 antibody

    70R-1638 100 ug
    EUR 377
    Description: Rabbit polyclonal DVL1 antibody

    DVL1 antibody

    70R-1639 100 ug
    EUR 377
    Description: Rabbit polyclonal DVL1 antibody

    DVL1 Antibody

    43257-100ul 100ul
    EUR 252

    DVL1 Antibody

    DF7515 200ul
    EUR 304
    Description: DVL1 Antibody detects endogenous levels of total DVL1.

    DVL1 Antibody

    ABD7515 100 ug
    EUR 438

    DVL1 antibody

    PAab09841 100 ug
    EUR 386

    DVL1 Conjugated Antibody

    C43257 100ul
    EUR 397

    anti- DVL1 antibody

    FNab09841 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:2000
    • IHC: 1:50-1:500
    • Immunogen: dishevelled, dsh homolog 1
    • Uniprot ID: O14640
    • Gene ID: 1855
    • Research Area: Neuroscience, Signal Transduction, Developmental biology
    Description: Antibody raised against DVL1

    anti- DVL1 antibody

    LSMab09841 100 ug
    EUR 386

    Anti-DVL1 antibody

    STJ116411 100 µl
    EUR 277
    Description: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.

    Anti-DVL1 antibody

    STJ192994 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DVL1

    DVL1 siRNA

    20-abx901607
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DVL1 siRNA

    20-abx914783
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DVL1 siRNA

    20-abx914784
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-DVL1

    YF-PA27212 50 ug
    EUR 363
    Description: Mouse polyclonal to DVL1

    Polyclonal DVL1 / DVL / Dishevelled Antibody (aa20-32)

    APC00111G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DVL1 / DVL / Dishevelled (aa20-32). This antibody is tested and proven to work in the following applications:

    Anti-Dishevelled/Dvl1 Antibody

    A03533-1 100ug/vial
    EUR 334

    Anti-Dvl1 (mouse) antibody

    STJ72776 100 µg
    EUR 359

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human)

    4-PAJ540Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1)

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse)

    4-PAJ540Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1)

    DVL1 Blocking Peptide

    33R-5088 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DVL1 antibody, catalog no. 70R-1638

    DVL1 Blocking Peptide

    33R-1019 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of ACADM antibody, catalog no. 70R-2483

    DVL1 Blocking Peptide

    DF7515-BP 1mg
    EUR 195

    DVL1 cloning plasmid

    CSB-CL007284HU-10ug 10ug
    EUR 483
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1335
    • Sequence: atggcggagaccaagattatctaccacatggacgaggaggagacgccgtacctggtcaagctgcccgtggcccccgagcgcgtcacgctggccgacttcaagaacgtgctcagcaaccggcccgtgcacgcctacaaattcttctttaagtccatggaccaggacttcggggtgg
    • Show more
    Description: A cloning plasmid for the DVL1 gene.

    anti-Dishevelled / Dvl1

    YF-PA11452 50 ul
    EUR 363
    Description: Mouse polyclonal to Dishevelled / Dvl1

    anti-Dishevelled / Dvl1

    YF-PA11453 100 ug
    EUR 403
    Description: Rabbit polyclonal to Dishevelled / Dvl1

    anti-Dishevelled / Dvl1

    YF-PA23616 50 ul
    EUR 334
    Description: Mouse polyclonal to Dishevelled / Dvl1

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC

    4-PAJ540Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Biotinylated

    4-PAJ540Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), Cy3

    4-PAJ540Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), FITC

    4-PAJ540Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), HRP

    4-PAJ540Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), PE

    4-PAJ540Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC

    4-PAJ540Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Biotinylated

    4-PAJ540Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Biotin.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), Cy3

    4-PAJ540Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with Cy3.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), FITC

    4-PAJ540Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with FITC.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), HRP

    4-PAJ540Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with HRP.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), PE

    4-PAJ540Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with PE.

    Human DVL1 ELISA Kit

    ELA-E15104h 96 Tests
    EUR 824

    DVL1 ELISA KIT|Human

    EF005905 96 Tests
    EUR 689

    Rat DVL1 shRNA Plasmid

    20-abx986842
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse DVL1 shRNA Plasmid

    20-abx970078
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human DVL1 shRNA Plasmid

    20-abx951301
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    DVL1 Recombinant Protein (Human)

    RP009988 100 ug Ask for price

    DVL1 Recombinant Protein (Rat)

    RP198854 100 ug Ask for price

    DVL1 Recombinant Protein (Mouse)

    RP130349 100 ug Ask for price

    Dishevelled, Dsh Homolog 1 (DVL1) Antibody

    20-abx102614
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Dishevelled, Dsh Homolog 1 (DVL1) Antibody

    20-abx102615
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Human), APC-Cy7

    4-PAJ540Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Lys285)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7.

    Dishevelled, Dsh Homolog 1 (DVL1) Polyclonal Antibody (Mouse), APC-Cy7

    4-PAJ540Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: DVL1 (Arg150~Ser332)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Dishevelled, Dsh Homolog 1 (DVL1). This antibody is labeled with APC-Cy7.

    Dvl1 ORF Vector (Rat) (pORF)

    ORF066286 1.0 ug DNA
    EUR 506

    DVL1 ORF Vector (Human) (pORF)

    ORF003330 1.0 ug DNA
    EUR 95

    Dvl1 ORF Vector (Mouse) (pORF)

    ORF043451 1.0 ug DNA
    EUR 506

    DVL1 ELISA Kit (Human) (OKEH02504)

    OKEH02504 96 Wells
    EUR 779
    Description: Description of target: DVL1, the human homolog of the Drosophila dishevelled gene (dsh) encodes a cytoplasmic phosphoprotein that regulates cell proliferation, acting as a transducer molecule for developmental processes, including segmentation and neuroblast specification. DVL1 is a candidate gene for neuroblastomatous transformation. The Schwartz-Jampel syndrome and Charcot-Marie-Tooth disease type 2A have been mapped to the same region as DVL1. The phenotypes of these diseases may be consistent with defects which might be expected from aberrant expression of a DVL gene during development.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.021 ng/mL

    DVL1 sgRNA CRISPR Lentivector set (Human)

    K0642301 3 x 1.0 ug
    EUR 339

    Dvl1 sgRNA CRISPR Lentivector set (Rat)

    K6997701 3 x 1.0 ug
    EUR 339

    Dvl1 sgRNA CRISPR Lentivector set (Mouse)

    K3976501 3 x 1.0 ug
    EUR 339

    Recombinant Dishevelled, Dsh Homolog 1 (DVL1)

    4-RPJ540Hu01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: O14640
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 19.0kDa
    • Isoelectric Point: 11.1
    Description: Recombinant Human Dishevelled, Dsh Homolog 1 expressed in: E.coli

    Recombinant Dishevelled, Dsh Homolog 1 (DVL1)

    4-RPJ540Mu01
    • EUR 512.16
    • EUR 240.00
    • EUR 1645.60
    • EUR 615.20
    • EUR 1130.40
    • EUR 406.00
    • EUR 3964.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P51141
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 24.0kDa
    • Isoelectric Point: 8.1
    Description: Recombinant Mouse Dishevelled, Dsh Homolog 1 expressed in: E.coli

    Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody

    abx026731-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Segment Polarity Protein Dishevelled Homolog DVL-1 (DVL1) Antibody

    abx026731-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Segment Polarity Protein Dishevelled Homolog DVL-1 (Dvl1) Antibody

    abx431219-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Mouse Dishevelled, Dsh Homolog 1 (DVL1) Protein

    20-abx066347
    • EUR 718.00
    • EUR 286.00
    • EUR 2221.00
    • EUR 857.00
    • EUR 509.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human Dishevelled, Dsh Homolog 1 (DVL1) Protein

    20-abx066348
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    DVL1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0642302 1.0 ug DNA
    EUR 154

    DVL1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0642303 1.0 ug DNA
    EUR 154

    DVL1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0642304 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6997702 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6997703 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6997704 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3976502 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3976503 1.0 ug DNA
    EUR 154

    Dvl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3976504 1.0 ug DNA
    EUR 154

    DVL1 Protein Vector (Mouse) (pPB-C-His)

    PV173802 500 ng
    EUR 1065

    DVL1 Protein Vector (Mouse) (pPB-N-His)

    PV173803 500 ng
    EUR 1065

    DVL1 Protein Vector (Mouse) (pPM-C-HA)

    PV173804 500 ng
    EUR 1065

    DVL1 Protein Vector (Mouse) (pPM-C-His)

    PV173805 500 ng
    EUR 1065

    DVL1 Protein Vector (Rat) (pPB-C-His)

    PV265142 500 ng
    EUR 1166

    DVL1 Protein Vector (Rat) (pPB-N-His)

    PV265143 500 ng
    EUR 1166

    DVL1 Protein Vector (Rat) (pPM-C-HA)

    PV265144 500 ng
    EUR 1166

    DVL1 Protein Vector (Rat) (pPM-C-His)

    PV265145 500 ng
    EUR 1166

    DVL1 Protein Vector (Human) (pPB-C-His)

    PV013317 500 ng
    EUR 329

    DVL1 Protein Vector (Human) (pPB-N-His)

    PV013318 500 ng
    EUR 329

    DVL1 Protein Vector (Human) (pPM-C-HA)

    PV013319 500 ng
    EUR 329

    DVL1 Protein Vector (Human) (pPM-C-His)

    PV013320 500 ng
    EUR 329

    Dvl1 3'UTR GFP Stable Cell Line

    TU155471 1.0 ml Ask for price

    Dvl1 3'UTR Luciferase Stable Cell Line

    TU105471 1.0 ml Ask for price

    Dvl1 3'UTR Luciferase Stable Cell Line

    TU203704 1.0 ml Ask for price

    Dvl1 3'UTR GFP Stable Cell Line

    TU253704 1.0 ml Ask for price

    DVL1 3'UTR GFP Stable Cell Line

    TU056444 1.0 ml
    EUR 1394

    DVL1 3'UTR Luciferase Stable Cell Line

    TU006444 1.0 ml
    EUR 1394

    DVL1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

    LV666133 1.0 ug DNA
    EUR 1355

    DVL1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

    LV666137 1.0 ug DNA
    EUR 1355

    DVL1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

    LV666138 1.0 ug DNA
    EUR 1355

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    NM23A Rabbit Polyclonal Antibody

    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    ATM Rabbit Polyclonal Antibody

    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    FAK Rabbit Polyclonal Antibody

    ABP57588-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    FAK Rabbit Polyclonal Antibody

    ABP57588-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    FAK Rabbit Polyclonal Antibody

    ABP57588-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    DVL1 Rabbit Polyclonal Antibody