MYH9 Rabbit Polyclonal Antibody

MYH9 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    MYH9 Polyclonal Antibody

    ABP59367-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human MYH9 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of MYH9 from Human, Mouse, Rat. This MYH9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH9 protein

    MYH9 Polyclonal Antibody

    ABP59367-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human MYH9 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of MYH9 from Human, Mouse, Rat. This MYH9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH9 protein

    MYH9 Polyclonal Antibody

    ABP59367-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human MYH9 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of MYH9 from Human, Mouse, Rat. This MYH9 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH9 protein

    MYH9 Polyclonal Antibody

    A53889 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    MYH9 Rabbit pAb

    A0173-100ul 100 ul
    EUR 308

    MYH9 Rabbit pAb

    A0173-200ul 200 ul
    EUR 459

    MYH9 Rabbit pAb

    A0173-20ul 20 ul
    EUR 183

    MYH9 Rabbit pAb

    A0173-50ul 50 ul
    EUR 223

    MYH9 Rabbit pAb

    A16923-100ul 100 ul
    EUR 308

    MYH9 Rabbit pAb

    A16923-200ul 200 ul
    EUR 459

    MYH9 Rabbit pAb

    A16923-20ul 20 ul
    EUR 183

    MYH9 Rabbit pAb

    A16923-50ul 50 ul
    EUR 223

    Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

    DLR-MYH9-Hu-48T 48T
    EUR 517
    • Should the Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 9, Non Muscle (MYH9) in samples from serum, plasma or other biological fluids.

    Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

    DLR-MYH9-Hu-96T 96T
    EUR 673
    • Should the Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 9, Non Muscle (MYH9) in samples from serum, plasma or other biological fluids.

    Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

    RD-MYH9-Hu-48Tests 48 Tests
    EUR 521

    Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

    RD-MYH9-Hu-96Tests 96 Tests
    EUR 723

    Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

    RDR-MYH9-Hu-48Tests 48 Tests
    EUR 544

    Human Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

    RDR-MYH9-Hu-96Tests 96 Tests
    EUR 756

    MYH9 antibody

    70R-51307 100 ul
    EUR 244
    Description: Purified Polyclonal MYH9 antibody

    MYH9 antibody

    70R-2739 50 ug
    EUR 467
    Description: Rabbit polyclonal MYH9 antibody raised against the middle region of MYH9

    MYH9 Antibody

    ABD8574 100 ug
    EUR 438

    MYH9 Antibody

    45364-100ul 100ul
    EUR 252

    MYH9 Antibody

    45364-50ul 50ul
    EUR 187

    MYH9 antibody

    70R-18705 50 ul
    EUR 435
    Description: Rabbit polyclonal MYH9 antibody

    MYH9 Antibody

    DF8574 200ul
    EUR 304
    Description: MYH9 Antibody detects endogenous levels of total MYH9.

    MYH9 Antibody

    1-CSB-PA01405A0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

    MYH9 Antibody

    1-CSB-PA015303GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    Polyclonal MYH9 Antibody (internal region)

    APR17492G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human MYH9 (internal region). This antibody is tested and proven to work in the following applications:

    Polyclonal MYH9 Antibody (C-term)

    APR17493G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYH9 (C-term). This antibody is tested and proven to work in the following applications:

    Polyclonal Phospho-MYH9(Y158) Antibody

    APR14366G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Phospho-MYH9(Y158) . This antibody is tested and proven to work in the following applications:

    MYH9 Polyclonal Antibody, HRP Conjugated

    A53890 100 µg
    EUR 570.55
    Description: fast delivery possible

    MYH9 Polyclonal Antibody, FITC Conjugated

    A53891 100 µg
    EUR 570.55
    Description: reagents widely cited

    MYH9 Polyclonal Antibody, Biotin Conjugated

    A53892 100 µg
    EUR 570.55
    Description: Ask the seller for details

    Polyclonal MYH9 Antibody (N-term Y158)

    APR17498G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MYH9 (N-term Y158). This antibody is tested and proven to work in the following applications:

    Phospho-MYH9-S1943 Rabbit pAb

    AP0802-100ul 100 ul
    EUR 384

    Phospho-MYH9-S1943 Rabbit pAb

    AP0802-200ul 200 ul
    EUR 554

    Phospho-MYH9-S1943 Rabbit pAb

    AP0802-20ul 20 ul
    EUR 183

    Phospho-MYH9-S1943 Rabbit pAb

    AP0802-50ul 50 ul
    EUR 265

    MYH9 Conjugated Antibody

    C45364 100ul
    EUR 397

    anti- MYH9 antibody

    FNab05479 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:1000 - 1:2000
    • IHC: 1:50 - 1:100
    • Immunogen: myosin, heavy chain 9, non-muscle
    • Uniprot ID: P35579
    • Gene ID: 4627
    • Research Area: Immunology, Developmental biology
    Description: Antibody raised against MYH9

    anti- Myh9 antibody

    FNab05480 100µg
    EUR 585
    • Recommended dilution: WB : 1:500-1:2000
    • IHC : 1:20-1:200
    • IF : 1:50-1:500
    • Immunogen: myosin, heavy polypeptide 9, non-muscle
    • Uniprot ID: P35579
    • Gene ID: 4627
    • Research Area: Immunology, Developmental biology
    Description: Antibody raised against Myh9

    anti- Myh9 antibody

    FNab05481 100µg
    EUR 585
    • Immunogen: myosin, heavy polypeptide 9, non-muscle
    • Uniprot ID: Q8VDD5
    • Gene ID: 17886
    • Research Area: Immunology, Developmental biology
    Description: Antibody raised against Myh9

    anti- MYH9 antibody

    FNab05482 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:1000-1:5000
    • Immunogen: myosin, heavy chain 9, non-muscle
    • Uniprot ID: P35579
    • Gene ID: 4627
    • Research Area: Immunology, Developmental biology
    Description: Antibody raised against MYH9

    MYH9 (pY158) Antibody

    abx032117-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    MYH9 (pY158) Antibody

    abx032117-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Anti-MYH9 antibody

    PAab05479 100 ug
    EUR 355

    Anti-Myh9 antibody

    PAab05480 100 ug
    EUR 412

    Anti-Myh9 antibody

    PAab05481 100 ug
    EUR 412

    Anti-MYH9 antibody

    STJ73316 100 µg
    EUR 359

    Anti-MYH9 antibody

    STJ24664 100 µl
    EUR 277
    Description: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.

    Anti-MYH9 antibody

    STJ119260 100 µl
    EUR 277

    Anti-MYH9 antibody

    STJ193078 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to MYH9

    MYH9 siRNA

    20-abx903417
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MYH9 siRNA

    20-abx925159
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MYH9 siRNA

    20-abx925160
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MYH9 protein

    30R-3272 50 ug
    EUR 257
    Description: Purified recombinant MYH9 protein

    pOTB7-MYH9

    PVT17683 2 ug
    EUR 231

    MYH9 Antibody, HRP conjugated

    1-CSB-PA01405B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    MYH9 Antibody, FITC conjugated

    1-CSB-PA01405C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    MYH9 Antibody, Biotin conjugated

    1-CSB-PA01405D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MYH9. Recognizes MYH9 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    MYH9 cloning plasmid

    CSB-CL015303HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 429
    • Sequence: atggcaaagcggatggggctgaggccaaacctgccgaataagcctcttctcctgcagcctgagatggatggacagacagacaccacagcctccccttcccagaccccgcagcacgcctctccccaccttcttgggactgctgtgaacatgcctcctcctgccctccgccccgtccc
    • Show more
    Description: A cloning plasmid for the MYH9 gene.

    MYH9 Blocking Peptide

    33R-1860 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH9 antibody, catalog no. 70R-2739

    MYH9 Blocking Peptide

    DF8574-BP 1mg
    EUR 195

    anti-MYH9 (3C7)

    LF-MA10200 50 ug
    EUR 363
    Description: Mouse monoclonal to MYH9

    Anti-Phospho-MYH9-(S1943) antibody

    STJ117900 100 µl
    EUR 393
    Description: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.

    Rat MYH9 shRNA Plasmid

    20-abx985273
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human MYH9 ELISA Kit

    ELA-E0237h 96 Tests
    EUR 824

    MYH9 ELISA KIT|Human

    EF000516 96 Tests
    EUR 689

    Human MYH9 shRNA Plasmid

    20-abx953054
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse MYH9 shRNA Plasmid

    20-abx971649
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human Myosin-9 (MYH9)

    1-CSB-RP014054h
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 54.2 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Myosin-9(MYH9) ,partial expressed in E.coli

    Monoclonal MYH9 Antibody (clone 2B3), Clone: 2B3

    APR17494G 0.05mg
    EUR 528
    Description: A Monoclonal antibody against Human MYH9 (clone 2B3). The antibodies are raised in Mouse and are from clone 2B3. This antibody is applicable in WB and IHC-P, IF, E

    Monoclonal MYH9 Antibody (clone 4H3), Clone: 4H3

    APR17495G 0.05mg
    EUR 528
    Description: A Monoclonal antibody against Human MYH9 (clone 4H3). The antibodies are raised in Mouse and are from clone 4H3. This antibody is applicable in WB and IHC-P, IF, E

    Monoclonal MYH9 Antibody (monoclonal) (M05), Clone: 1H6

    APR17496G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human MYH9 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 1H6. This antibody is applicable in WB and IF, E

    Monoclonal MYH9 Antibody (monoclonal) (M06), Clone: 4H3

    APR17497G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human MYH9 (monoclonal) (M06). The antibodies are raised in mouse and are from clone 4H3. This antibody is applicable in WB, IHC and IF, E

    Rabbit Myosin Heavy Chain 9, Non Muscle (MYH9) ELISA Kit

    abx363683-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    MYH9 ORF Vector (Human) (pORF)

    ORF006827 1.0 ug DNA
    EUR 95

    Myh9 ORF Vector (Mouse) (pORF)

    ORF050865 1.0 ug DNA
    EUR 1572

    Myh9 ORF Vector (Rat) (pORF)

    ORF070986 1.0 ug DNA
    EUR 2080

    MYH9 ELISA Kit (Human) (OKAN06605)

    OKAN06605 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

    MYH9 ELISA Kit (Human) (OKCD08480)

    OKCD08480 96 Wells
    EUR 975
    Description: Description of target: MYH9 is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain. The protein is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in MYH9 are the cause of non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

    MYH9 ELISA Kit (Dog) (OKEH03958)

    OKEH03958 96 Wells
    EUR 844
    Description: Description of target: Cellular myosin that appears to play a role in cytokinesis, cell shape, and specialized functions such as secretion and capping. During cell spreading, plays an important role in cytoskeleton reorganization, focal contacts formation (in the margins but not the central part of spreading cells), and lamellipodial retraction; this function is mechanically antagonized by MYH10 (By similarity).;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10.7 pg/mL

    MYH9 ELISA Kit (Human) (OKEH04168)

    OKEH04168 96 Wells
    EUR 662
    Description: Description of target: This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10 pg/mL

    MYH9 ELISA Kit (Mouse) (OKEH05897)

    OKEH05897 96 Wells
    EUR 662
    Description: Description of target: During cell spreading, plays an important role in cytoskeleton reorganization, focal contacts formation (in the margins but not the central part of spreading cells), and lamellipodial retraction; this function is mechanically antagonized by MYH10. Cellular myosin that appears to play a role in cytokinesis, cell shape, and specialized functions such as secretion and capping.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.68 pg/mL

    MYH9 ELISA Kit (Rat) (OKEH06324)

    OKEH06324 96 Wells
    EUR 662
    Description: Description of target: During cell spreading, plays an important role in cytoskeleton reorganization, focal contacts formation (in the margins but not the central part of spreading cells), and lamellipodial retraction; this function is mechanically antagonized by MYH10. Cellular myosin that appears to play a role in cytokinesis, cell shape, and specialized functions such as secretion and capping.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 39.6 pg/mL

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    20-abx113947
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    20-abx110021
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    20-abx000580
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    abx030030-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    abx030030-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    20-abx173685
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    20-abx177681
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    20-abx217007
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    abx433004-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    abx235479-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Myosin Heavy Chain 9, Non Muscle (Myh9) Antibody

    abx235480-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Myosin Heavy Chain 9, Non Muscle (Myh9) Antibody

    abx235481-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody

    abx235482-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Human MYH9/ Myosin-9 ELISA Kit

    E1692Hu 1 Kit
    EUR 571

    Human MYH9(Myosin-9) ELISA Kit

    EH0791 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P35579
    • Alias: MYH9(Myosin Heavy Chain 9, Non Muscle)/MHA/FTNS/EPSTS/Myosin-9/Non-muscle myosin heavy chain Iia/Myosin heavy chain 9/Myosin heavy chain, non-muscle Iia
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

    Dog MYH9/ Myosin-9 ELISA Kit

    E0077Do 1 Kit
    EUR 717

    MYH9 sgRNA CRISPR Lentivector set (Human)

    K1374501 3 x 1.0 ug
    EUR 339

    Myh9 sgRNA CRISPR Lentivector set (Mouse)

    K4826201 3 x 1.0 ug
    EUR 339

    Myh9 sgRNA CRISPR Lentivector set (Rat)

    K6807801 3 x 1.0 ug
    EUR 339

    pcDNA3.1(+)-MYH9(83-764aa)-HA Plasmid

    PVTB00946-2a 2 ug
    EUR 356

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody Pair

    abx117448-1pair5x96wellplates 1 pair (5x96 well plates)
    EUR 1010
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (HRP)

    20-abx108530
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (Biotin)

    20-abx105692
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Myosin Heavy Chain 9, Non Muscle (MYH9) Antibody (FITC)

    20-abx107109
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    MYH9 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1374502 1.0 ug DNA
    EUR 154

    MYH9 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1374503 1.0 ug DNA
    EUR 154

    MYH9 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1374504 1.0 ug DNA
    EUR 154

    Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4826202 1.0 ug DNA
    EUR 154

    Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4826203 1.0 ug DNA
    EUR 154

    Myh9 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4826204 1.0 ug DNA
    EUR 154

    Myh9 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6807802 1.0 ug DNA
    EUR 154

    Myh9 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6807803 1.0 ug DNA
    EUR 154

    Myh9 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6807804 1.0 ug DNA
    EUR 154

    MYH9 Protein Vector (Rat) (pPB-C-His)

    PV283942 500 ng
    EUR 3240

    MYH9 Protein Vector (Rat) (pPB-N-His)

    PV283943 500 ng
    EUR 3240

    MYH9 Protein Vector (Rat) (pPM-C-HA)

    PV283944 500 ng
    EUR 3240

    MYH9 Protein Vector (Rat) (pPM-C-His)

    PV283945 500 ng
    EUR 3240

    MYH9 Protein Vector (Human) (pPB-C-His)

    PV027305 500 ng
    EUR 329

    MYH9 Protein Vector (Human) (pPB-N-His)

    PV027306 500 ng
    EUR 329

    MYH9 Protein Vector (Human) (pPM-C-HA)

    PV027307 500 ng
    EUR 329

    MYH9 Protein Vector (Human) (pPM-C-His)

    PV027308 500 ng
    EUR 329

    MYH9 Protein Vector (Mouse) (pPB-C-His)

    PV203458 500 ng
    EUR 3238

    MYH9 Protein Vector (Mouse) (pPB-N-His)

    PV203459 500 ng
    EUR 3238

    MYH9 Protein Vector (Mouse) (pPM-C-HA)

    PV203460 500 ng
    EUR 3238

    MYH9 Protein Vector (Mouse) (pPM-C-His)

    PV203461 500 ng
    EUR 3238

    Myh9 3'UTR GFP Stable Cell Line

    TU163711 1.0 ml Ask for price

    Myh9 3'UTR Luciferase Stable Cell Line

    TU213631 1.0 ml Ask for price

    MYH9 3'UTR Luciferase Stable Cell Line

    TU015040 1.0 ml
    EUR 1521

    Myh9 3'UTR Luciferase Stable Cell Line

    TU113711 1.0 ml Ask for price

    MYH9 3'UTR GFP Stable Cell Line

    TU065040 1.0 ml
    EUR 1521

    Myh9 3'UTR GFP Stable Cell Line

    TU263631 1.0 ml Ask for price

    MYH9 Rabbit Polyclonal Antibody