SSR3 Rabbit Polyclonal Antibody

SSR3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

SSR3 Polyclonal Antibody
ABP60521-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420 Applications tips:
Description: A polyclonal antibody for detection of SSR3 from Human. This SSR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420

SSR3 Polyclonal Antibody
A61154	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

SSR3 Polyclonal Antibody
30215-100ul	SAB	100ul	EUR 252

SSR3 Polyclonal Antibody
30215-50ul	SAB	50ul	EUR 187

SSR3 Rabbit pAb
A17873-100ul	Abclonal	100 ul	EUR 308

SSR3 Rabbit pAb
A17873-200ul	Abclonal	200 ul	EUR 459

SSR3 Rabbit pAb
A17873-20ul	Abclonal	20 ul	EUR 183

SSR3 Rabbit pAb
A17873-50ul	Abclonal	50 ul	EUR 223

SSR3 Polyclonal Conjugated Antibody
C30215	SAB	100ul	EUR 397

SSR3 antibody
70R-14333	Fitzgerald	100 ug	EUR 322
Description: Affinity purified Rabbit polyclonal SSR3 antibody

SSR3 Antibody
1-CSB-PA892358LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

SSR3 Polyclonal Antibody, Biotin Conjugated
A61155	EpiGentek	100 µg	EUR 570.55
Description: fast delivery possible

SSR3 Polyclonal Antibody, FITC Conjugated
A61156	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

SSR3 Polyclonal Antibody, HRP Conjugated
A61157	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

Ssr3/ Rat Ssr3 ELISA Kit
ELI-52920r	Lifescience Market	96 Tests	EUR 886

Anti-SSR3 Antibody
PA1796	BosterBio	100ug/vial	EUR 334

Anti-SSR3 antibody
STJ119884	St John's Laboratory	100 µl	EUR 277
Description: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR is comprised of four membrane proteins/subunits: alpha, beta, gamma, and delta. The first two are glycosylated subunits and the latter two are non-glycosylated subunits. This gene encodes the gamma subunit, which is predicted to span the membrane four times.

Anti-SSR3 antibody
STJ192644	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to SSR3

SSR3 siRNA
20-abx905293	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SSR3 siRNA
20-abx935268	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

SSR3 siRNA
20-abx935269	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pENTR223- SSR3
PVT10076	Lifescience Market	2 ug	EUR 266

SSR3 Antibody, HRP conjugated
1-CSB-PA892358LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

SSR3 Antibody, FITC conjugated
1-CSB-PA892358LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

SSR3 Antibody, Biotin conjugated
1-CSB-PA892358LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

SSR3 cloning plasmid
CSB-CL892358HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 558 Sequence: atggctcctaaaggcagctccaaacagcagtctgaggaggacctgctcctgcaggatttcagccgcaatctctcggccaagtcctccgcgctcttcttcggaaacgcgttcatcgtgtctgccatccccatctggttatactggcgaatatggcatatggatcttattcagtctgc Show more
Description: A cloning plasmid for the SSR3 gene.

Mouse SSR3 shRNA Plasmid
20-abx976140	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat SSR3 shRNA Plasmid
20-abx986715	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Bovine SSR3 ELISA KIT
ELI-18144b	Lifescience Market	96 Tests	EUR 928

SSR3 ELISA KIT|Human
EF005570	Lifescience Market	96 Tests	EUR 689

Human SSR3 ELISA KIT
ELI-29885h	Lifescience Market	96 Tests	EUR 824

Mouse Ssr3 ELISA KIT
ELI-29886m	Lifescience Market	96 Tests	EUR 865

Human SSR3 shRNA Plasmid
20-abx954610	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

SSR3 Recombinant Protein (Human)
RP030172	ABM	100 ug	Ask for price

SSR3 Recombinant Protein (Rat)
RP231188	ABM	100 ug	Ask for price

SSR3 Recombinant Protein (Mouse)
RP175640	ABM	100 ug	Ask for price

pECMV-3-FLAG-SSR3
PVT12354	Lifescience Market	2 ug	EUR 703

Translocon-Associated Protein Subunit Gamma (SSR3) Antibody
20-abx302939	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Ssr3 ORF Vector (Mouse) (pORF)
ORF058548	ABM	1.0 ug DNA	EUR 506

SSR3 ORF Vector (Human) (pORF)
ORF010058	ABM	1.0 ug DNA	EUR 95

Ssr3 ORF Vector (Rat) (pORF)
ORF077064	ABM	1.0 ug DNA	EUR 506

Translocon-Associated Protein Subunit Gamma (SSR3) Antibody (HRP)
20-abx312289	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Translocon-Associated Protein Subunit Gamma (SSR3) Antibody (FITC)
20-abx312290	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Translocon-Associated Protein Subunit Gamma (SSR3) Antibody (Biotin)
20-abx312291	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

SSR3 sgRNA CRISPR Lentivector set (Human)
K2290501	ABM	3 x 1.0 ug	EUR 339

Ssr3 sgRNA CRISPR Lentivector set (Mouse)
K3670601	ABM	3 x 1.0 ug	EUR 339

Ssr3 sgRNA CRISPR Lentivector set (Rat)
K7040401	ABM	3 x 1.0 ug	EUR 339

SSR3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2290502	ABM	1.0 ug DNA	EUR 154

SSR3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2290503	ABM	1.0 ug DNA	EUR 154

SSR3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2290504	ABM	1.0 ug DNA	EUR 154

Ssr3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3670602	ABM	1.0 ug DNA	EUR 154

Ssr3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3670603	ABM	1.0 ug DNA	EUR 154

Ssr3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3670604	ABM	1.0 ug DNA	EUR 154

Ssr3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7040402	ABM	1.0 ug DNA	EUR 154

Ssr3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7040403	ABM	1.0 ug DNA	EUR 154

Ssr3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7040404	ABM	1.0 ug DNA	EUR 154

SSR3 Protein Vector (Human) (pPB-C-His)
PV040229	ABM	500 ng	EUR 329

SSR3 Protein Vector (Human) (pPB-N-His)
PV040230	ABM	500 ng	EUR 329

SSR3 Protein Vector (Human) (pPM-C-HA)
PV040231	ABM	500 ng	EUR 329

SSR3 Protein Vector (Human) (pPM-C-His)
PV040232	ABM	500 ng	EUR 329

SSR3 Protein Vector (Rat) (pPB-C-His)
PV308254	ABM	500 ng	EUR 603

SSR3 Protein Vector (Rat) (pPB-N-His)
PV308255	ABM	500 ng	EUR 603

SSR3 Protein Vector (Rat) (pPM-C-HA)
PV308256	ABM	500 ng	EUR 603

SSR3 Protein Vector (Rat) (pPM-C-His)
PV308257	ABM	500 ng	EUR 603

SSR3 Rabbit Polyclonal Antibody