SSR3 Rabbit Polyclonal Antibody

SSR3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    SSR3 Polyclonal Antibody

    ABP60521-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420
    • Applications tips:
    Description: A polyclonal antibody for detection of SSR3 from Human. This SSR3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human SSR3 protein at amino acid sequence of 340-420

    SSR3 Polyclonal Antibody

    A61154 100 µg
    EUR 570.55
    Description: kits suitable for this type of research

    SSR3 Polyclonal Antibody

    30215-100ul 100ul
    EUR 252

    SSR3 Polyclonal Antibody

    30215-50ul 50ul
    EUR 187

    SSR3 Rabbit pAb

    A17873-100ul 100 ul
    EUR 308

    SSR3 Rabbit pAb

    A17873-200ul 200 ul
    EUR 459

    SSR3 Rabbit pAb

    A17873-20ul 20 ul
    EUR 183

    SSR3 Rabbit pAb

    A17873-50ul 50 ul
    EUR 223

    SSR3 Polyclonal Conjugated Antibody

    C30215 100ul
    EUR 397

    SSR3 antibody

    70R-14333 100 ug
    EUR 322
    Description: Affinity purified Rabbit polyclonal SSR3 antibody

    SSR3 Antibody

    1-CSB-PA892358LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

    SSR3 Polyclonal Antibody, Biotin Conjugated

    A61155 100 µg
    EUR 570.55
    Description: fast delivery possible

    SSR3 Polyclonal Antibody, FITC Conjugated

    A61156 100 µg
    EUR 570.55
    Description: reagents widely cited

    SSR3 Polyclonal Antibody, HRP Conjugated

    A61157 100 µg
    EUR 570.55
    Description: Ask the seller for details

    Ssr3/ Rat Ssr3 ELISA Kit

    ELI-52920r 96 Tests
    EUR 886

    Anti-SSR3 Antibody

    PA1796 100ug/vial
    EUR 334

    Anti-SSR3 antibody

    STJ119884 100 µl
    EUR 277
    Description: The signal sequence receptor (SSR) is a glycosylated endoplasmic reticulum (ER) membrane receptor associated with protein translocation across the ER membrane. The SSR is comprised of four membrane proteins/subunits: alpha, beta, gamma, and delta. The first two are glycosylated subunits and the latter two are non-glycosylated subunits. This gene encodes the gamma subunit, which is predicted to span the membrane four times.

    Anti-SSR3 antibody

    STJ192644 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to SSR3

    SSR3 siRNA

    20-abx905293
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SSR3 siRNA

    20-abx935268
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    SSR3 siRNA

    20-abx935269
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    pENTR223- SSR3

    PVT10076 2 ug
    EUR 266

    SSR3 Antibody, HRP conjugated

    1-CSB-PA892358LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    SSR3 Antibody, FITC conjugated

    1-CSB-PA892358LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    SSR3 Antibody, Biotin conjugated

    1-CSB-PA892358LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against SSR3. Recognizes SSR3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    SSR3 cloning plasmid

    CSB-CL892358HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 558
    • Sequence: atggctcctaaaggcagctccaaacagcagtctgaggaggacctgctcctgcaggatttcagccgcaatctctcggccaagtcctccgcgctcttcttcggaaacgcgttcatcgtgtctgccatccccatctggttatactggcgaatatggcatatggatcttattcagtctgc
    • Show more
    Description: A cloning plasmid for the SSR3 gene.

    Mouse SSR3 shRNA Plasmid

    20-abx976140
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat SSR3 shRNA Plasmid

    20-abx986715
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Bovine SSR3 ELISA KIT

    ELI-18144b 96 Tests
    EUR 928

    SSR3 ELISA KIT|Human

    EF005570 96 Tests
    EUR 689

    Human SSR3 ELISA KIT

    ELI-29885h 96 Tests
    EUR 824

    Mouse Ssr3 ELISA KIT

    ELI-29886m 96 Tests
    EUR 865

    Human SSR3 shRNA Plasmid

    20-abx954610
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    SSR3 Recombinant Protein (Human)

    RP030172 100 ug Ask for price

    SSR3 Recombinant Protein (Rat)

    RP231188 100 ug Ask for price

    SSR3 Recombinant Protein (Mouse)

    RP175640 100 ug Ask for price

    pECMV-3-FLAG-SSR3

    PVT12354 2 ug
    EUR 703

    Translocon-Associated Protein Subunit Gamma (SSR3) Antibody

    20-abx302939
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Ssr3 ORF Vector (Mouse) (pORF)

    ORF058548 1.0 ug DNA
    EUR 506

    SSR3 ORF Vector (Human) (pORF)

    ORF010058 1.0 ug DNA
    EUR 95

    Ssr3 ORF Vector (Rat) (pORF)

    ORF077064 1.0 ug DNA
    EUR 506

    Translocon-Associated Protein Subunit Gamma (SSR3) Antibody (HRP)

    20-abx312289
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Translocon-Associated Protein Subunit Gamma (SSR3) Antibody (FITC)

    20-abx312290
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Translocon-Associated Protein Subunit Gamma (SSR3) Antibody (Biotin)

    20-abx312291
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    SSR3 sgRNA CRISPR Lentivector set (Human)

    K2290501 3 x 1.0 ug
    EUR 339

    Ssr3 sgRNA CRISPR Lentivector set (Mouse)

    K3670601 3 x 1.0 ug
    EUR 339

    Ssr3 sgRNA CRISPR Lentivector set (Rat)

    K7040401 3 x 1.0 ug
    EUR 339

    SSR3 sgRNA CRISPR Lentivector (Human) (Target 1)

    K2290502 1.0 ug DNA
    EUR 154

    SSR3 sgRNA CRISPR Lentivector (Human) (Target 2)

    K2290503 1.0 ug DNA
    EUR 154

    SSR3 sgRNA CRISPR Lentivector (Human) (Target 3)

    K2290504 1.0 ug DNA
    EUR 154

    Ssr3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3670602 1.0 ug DNA
    EUR 154

    Ssr3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3670603 1.0 ug DNA
    EUR 154

    Ssr3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3670604 1.0 ug DNA
    EUR 154

    Ssr3 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7040402 1.0 ug DNA
    EUR 154

    Ssr3 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7040403 1.0 ug DNA
    EUR 154

    Ssr3 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7040404 1.0 ug DNA
    EUR 154

    SSR3 Protein Vector (Human) (pPB-C-His)

    PV040229 500 ng
    EUR 329

    SSR3 Protein Vector (Human) (pPB-N-His)

    PV040230 500 ng
    EUR 329

    SSR3 Protein Vector (Human) (pPM-C-HA)

    PV040231 500 ng
    EUR 329

    SSR3 Protein Vector (Human) (pPM-C-His)

    PV040232 500 ng
    EUR 329

    SSR3 Protein Vector (Rat) (pPB-C-His)

    PV308254 500 ng
    EUR 603

    SSR3 Protein Vector (Rat) (pPB-N-His)

    PV308255 500 ng
    EUR 603

    SSR3 Protein Vector (Rat) (pPM-C-HA)

    PV308256 500 ng
    EUR 603

    SSR3 Protein Vector (Rat) (pPM-C-His)

    PV308257 500 ng
    EUR 603

    SSR3 Rabbit Polyclonal Antibody