HMGA1 Rabbit Polyclonal Antibody

HMGA1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    HMGA1 Polyclonal Antibody
    ES11843-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HMGA1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    HMGA1 Polyclonal Antibody
    ES11843-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HMGA1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    HMGA1 Rabbit pAb
    A1635-100ul 100 ul
    EUR 308
    HMGA1 Rabbit pAb
    A1635-200ul 200 ul
    EUR 459
    HMGA1 Rabbit pAb
    A1635-20ul 20 ul
    EUR 183
    HMGA1 Rabbit pAb
    A1635-50ul 50 ul
    EUR 223
    HMGA1 Rabbit pAb
    A12693-100ul 100 ul
    EUR 308
    HMGA1 Rabbit pAb
    A12693-200ul 200 ul
    EUR 459
    HMGA1 Rabbit pAb
    A12693-20ul 20 ul
    EUR 183
    HMGA1 Rabbit pAb
    A12693-50ul 50 ul
    EUR 223
    HMGA1 Rabbit mAb
    A4343-100ul 100 ul
    EUR 410
    HMGA1 Rabbit mAb
    A4343-200ul 200 ul
    EUR 571
    HMGA1 Rabbit mAb
    A4343-20ul 20 ul
    EUR 221
    HMGA1 Rabbit mAb
    A4343-50ul 50 ul
    EUR 287
    Polyclonal HMGIY / HMGA1 Antibody
    APG01093G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 . This antibody is tested and proven to work in the following applications:
    Polyclonal Goat Anti-HMGA1 Antibody
    APG00159G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 . This antibody is tested and proven to work in the following applications:
    Polyclonal HMGIY / HMGA1 Antibody (Internal)
    APG01040G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 (Internal). This antibody is tested and proven to work in the following applications:
    Polyclonal HMGA1 Antibody (C-term)
    APR06143G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGA1 (C-term). This antibody is tested and proven to work in the following applications:
    HMGA1 Antibody
    47493-100ul 100ul
    EUR 252
    HMGA1 Antibody
    47751-100ul 100ul
    EUR 252
    HMGA1 Antibody
    1-CSB-PA983341
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
    HMGA1 Antibody
    1-CSB-PA230265
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
    HMGA1 antibody
    70R-51289 100 ul
    EUR 244
    Description: Purified Polyclonal HMGA1 antibody
    HMGA1 Antibody
    AF5218 200ul
    EUR 304
    Description: HMGA1 Antibody detects endogenous levels of total HMGA1.
    HMGA1 Antibody
    ABF5218 100 ug
    EUR 438
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    DLR-HMGA1-c-48T 48T
    EUR 570
    • Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    DLR-HMGA1-c-96T 96T
    EUR 747
    • Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    DLR-HMGA1-Hu-48T 48T
    EUR 517
    • Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    DLR-HMGA1-Hu-96T 96T
    EUR 673
    • Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RDR-HMGA1-c-48Tests 48 Tests
    EUR 608
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RDR-HMGA1-c-96Tests 96 Tests
    EUR 847
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RDR-HMGA1-Hu-48Tests 48 Tests
    EUR 544
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RDR-HMGA1-Hu-96Tests 96 Tests
    EUR 756
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RD-HMGA1-c-48Tests 48 Tests
    EUR 581
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RD-HMGA1-c-96Tests 96 Tests
    EUR 809
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RD-HMGA1-Hu-48Tests 48 Tests
    EUR 521
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RD-HMGA1-Hu-96Tests 96 Tests
    EUR 723
    Polyclonal HMGIY / HMGA1 Antibody (aa1-53)
    APR03322G 0.05ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGIY / HMGA1 (aa1-53). This antibody is tested and proven to work in the following applications:
    HMGA1 Conjugated Antibody
    C47751 100ul
    EUR 397
    HMGA1 Conjugated Antibody
    C47493 100ul
    EUR 397
    Anti-HMGA1 antibody
    STJ28051 100 µl
    EUR 277
    Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.
    Anti-HMGA1 antibody
    STJ114566 100 µl
    EUR 277
    Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.
    Anti-HMGA1 antibody
    STJ193001 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to HMGA1
    Anti-HMGA1 antibody
    STJ70745 100 µg
    EUR 359
    Hmga1/ Rat Hmga1 ELISA Kit
    ELI-04846r 96 Tests
    EUR 886
    Polyclonal Goat Anti-HMGA1 (aa9-21) Antibody
    APG00158G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 (aa9-21) . This antibody is tested and proven to work in the following applications:
    HMGA1 siRNA
    20-abx902480
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    HMGA1 siRNA
    20-abx919597
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    HMGA1 siRNA
    20-abx919598
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Anti-HMGA1 (aa9-21) antibody
    STJ71997 100 µg
    EUR 359
    HMGA1 Blocking Peptide
    20-abx064164
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    HMGA1 Blocking Peptide
    AF5218-BP 1mg
    EUR 195
    HMGA1 cloning plasmid
    CSB-CL010545HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 291
    • Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccgaaggagcccagcgaagtgccaacacctaagagacctcggggccgaccaaagggaagcaaaaacaagggtgctgc
    • Show more
    Description: A cloning plasmid for the HMGA1 gene.
    HMGA1 cloning plasmid
    CSB-CL010545HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 324
    • Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccggtgagtcccgggacagcgctggtagggagtcagaaggagcccagcgaagtgccaacacctaagagacctcgggg
    • Show more
    Description: A cloning plasmid for the HMGA1 gene.
    HMGA1 protein (His tag)
    80R-1896 50 ug
    EUR 397
    Description: Purified recombinant HMGA1 protein
    Human HMGA1 ELISA Kit
    ELA-E1478h 96 Tests
    EUR 824
    Canine HMGA1 ELISA KIT
    ELI-04845d 96 Tests
    EUR 928
    HMGA1 ELISA KIT|Human
    EF005799 96 Tests
    EUR 689
    Rat HMGA1 shRNA Plasmid
    20-abx987402
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human HMGA1 shRNA Plasmid
    20-abx952156
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse HMGA1 shRNA Plasmid
    20-abx970825
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    HMGA1 Recombinant Protein (Human)
    RP014968 100 ug Ask for price
    HMGA1 Recombinant Protein (Human)
    RP014971 100 ug Ask for price
    HMGA1 Recombinant Protein (Rat)
    RP204716 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141815 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141818 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141821 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141824 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141827 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141830 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141833 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141836 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141839 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141842 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141845 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141848 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141851 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141854 100 ug Ask for price
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human)
    4-PAC050Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1)
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse)
    4-PAC050Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1)
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat)
    4-PAC050Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1)
    Hmga1 ORF Vector (Rat) (pORF)
    ORF068240 1.0 ug DNA
    EUR 506
    HMGA1 ORF Vector (Human) (pORF)
    ORF004990 1.0 ug DNA
    EUR 95
    HMGA1 ORF Vector (Human) (pORF)
    ORF004991 1.0 ug DNA
    EUR 95
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047273 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047274 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047275 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047276 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047277 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047278 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047279 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047280 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047281 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047282 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047283 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047284 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047285 1.0 ug DNA
    EUR 506
    Hmga1 ORF Vector (Mouse) (pORF)
    ORF047286 1.0 ug DNA
    EUR 506
    Hmga1-rs1 Recombinant Protein (Mouse)
    RP141857 100 ug Ask for price
    Hmga1-rs1 Recombinant Protein (Mouse)
    RP141860 100 ug Ask for price
    HMGA1 ELISA Kit (Human) (OKAN06579)
    OKAN06579 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.112 ng/mL
    HMGA1 ELISA Kit (Dog) (OKCD02589)
    OKCD02589 96 Wells
    EUR 936
    Description: Description of target: HMG-I/Y bind preferentially to the minor groove of A+T rich regions in double-stranded DNA. It is suggested that these proteins could function in nucleosome phasing and in the 3'-end processing of mRNA transcripts. They are also involved in the transcription regulation of genes containing, or in close proximity to A+T-rich regions. ;Species reactivity: Dog;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.115 ng/mL
    HMGA1 ELISA Kit (Human) (OKCD07955)
    OKCD07955 96 Wells
    EUR 975
    Description: Description of target: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.112ng/mL
    HMGA1 ELISA Kit (Rat) (OKEH06159)
    OKEH06159 96 Wells
    EUR 662
    Description: Description of target: HMG-I/Y bind preferentially to the minor groove of A+T rich regions in double-stranded DNA. It is suggested that these proteins could function in nucleosome phasing and in the 3'-end processing of mRNA transcripts. They are also involved in the transcription regulation of genes containing, or in close proximity to A+T-rich regions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.089 ng/mL
    HMGA1 ELISA Kit (Human) (OKEH04469)
    OKEH04469 96 Wells
    EUR 662
    Description: Description of target: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.039 ng/mL
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), APC
    4-PAC050Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), Biotinylated
    4-PAC050Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), Cy3
    4-PAC050Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), FITC
    4-PAC050Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), HRP
    4-PAC050Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), PE
    4-PAC050Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), APC
    4-PAC050Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), Biotinylated
    4-PAC050Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), Cy3
    4-PAC050Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), FITC
    4-PAC050Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), HRP
    4-PAC050Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), PE
    4-PAC050Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), APC
    4-PAC050Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), Biotinylated
    4-PAC050Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), Cy3
    4-PAC050Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), FITC
    4-PAC050Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), HRP
    4-PAC050Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), PE
    4-PAC050Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), APC-Cy7
    4-PAC050Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), APC-Cy7
    4-PAC050Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), APC-Cy7
    4-PAC050Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC-Cy7.
    Hmga1 sgRNA CRISPR Lentivector set (Rat)
    K7016301 3 x 1.0 ug
    EUR 339
    Hmga1 sgRNA CRISPR Lentivector set (Mouse)
    K4428901 3 x 1.0 ug
    EUR 339
    HMGA1 sgRNA CRISPR Lentivector set (Human)
    K0969001 3 x 1.0 ug
    EUR 339
    Hmga1-rs1 ORF Vector (Mouse) (pORF)
    ORF047287 1.0 ug DNA
    EUR 506
    Hmga1-rs1 ORF Vector (Mouse) (pORF)
    ORF047288 1.0 ug DNA
    EUR 506
    HMGA1-RS1 ELISA Kit (Mouse) (OKEH05471)
    OKEH05471 96 Wells
    EUR 662
    Description: Description of target: HMG-I/Y bind preferentially to the minor groove of A+T rich regions in double-stranded DNA. It is suggested that these proteins could function in nucleosome phasing and in the 3'-end processing of mRNA transcripts. They are also involved in the transcription regulation of genes containing, or in close proximity to A+T-rich regions. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.088 ng/mL
    High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
    20-abx214938
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
    20-abx176838
    • EUR 1358.00
    • EUR 648.00
    • 1 mg
    • 200 ug
    • Please enquire.
    High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
    20-abx104010
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
    20-abx104011
    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.
    High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
    20-abx104012
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
    20-abx172807
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
    20-abx172808
    • EUR 940.00
    • EUR 481.00
    • 1 mg
    • 200 ug
    • Please enquire.
    High Mobility Group AT Hook Protein 1 (HMGA1) Antibody
    20-abx242352
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    Rabbit Hemoglobin Polyclonal Antibody
    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Met Rabbit Polyclonal Antibody
    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    VEGF Rabbit Polyclonal Antibody
    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    CD10 Rabbit Polyclonal Antibody
    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    NM23A Rabbit Polyclonal Antibody
    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    ATM Rabbit Polyclonal Antibody
    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4b Rabbit Polyclonal Antibody
    ABP57577-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG4c Rabbit Polyclonal Antibody
    ABP57578-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG5 Rabbit Polyclonal Antibody
    ABP57579-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5
    ATG7 Rabbit Polyclonal Antibody
    ABP57580-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
    ATG7 Rabbit Polyclonal Antibody
    ABP57580-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
    ATG7 Rabbit Polyclonal Antibody
    ABP57580-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7
    ATG13 Rabbit Polyclonal Antibody
    ABP57581-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57581-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57581-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57582-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57582-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG13 Rabbit Polyclonal Antibody
    ABP57582-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13
    ATG14L Rabbit Polyclonal Antibody
    ABP57583-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
    ATG14L Rabbit Polyclonal Antibody
    ABP57583-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
    ATG14L Rabbit Polyclonal Antibody
    ABP57583-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L
    NBR1 Rabbit Polyclonal Antibody
    ABP57585-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57585-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57585-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57586-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57586-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    NBR1 Rabbit Polyclonal Antibody
    ABP57586-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1
    WIPI2 Rabbit Polyclonal Antibody
    ABP57587-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
    WIPI2 Rabbit Polyclonal Antibody
    ABP57587-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
    WIPI2 Rabbit Polyclonal Antibody
    ABP57587-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2
    FAK Rabbit Polyclonal Antibody
    ABP57588-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    HMGA1 Rabbit Polyclonal Antibody