HMGA1 Rabbit Polyclonal Antibody

HMGA1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

HMGA1 Polyclonal Antibody
ES11843-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HMGA1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HMGA1 Polyclonal Antibody
ES11843-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HMGA1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

HMGA1 Rabbit pAb
A1635-100ul	Abclonal	100 ul	EUR 308

HMGA1 Rabbit pAb
A1635-200ul	Abclonal	200 ul	EUR 459

HMGA1 Rabbit pAb
A1635-20ul	Abclonal	20 ul	EUR 183

HMGA1 Rabbit pAb
A1635-50ul	Abclonal	50 ul	EUR 223

HMGA1 Rabbit pAb
A12693-100ul	Abclonal	100 ul	EUR 308

HMGA1 Rabbit pAb
A12693-200ul	Abclonal	200 ul	EUR 459

HMGA1 Rabbit pAb
A12693-20ul	Abclonal	20 ul	EUR 183

HMGA1 Rabbit pAb
A12693-50ul	Abclonal	50 ul	EUR 223

HMGA1 Rabbit mAb
A4343-100ul	Abclonal	100 ul	EUR 410

HMGA1 Rabbit mAb
A4343-200ul	Abclonal	200 ul	EUR 571

HMGA1 Rabbit mAb
A4343-20ul	Abclonal	20 ul	EUR 221

HMGA1 Rabbit mAb
A4343-50ul	Abclonal	50 ul	EUR 287

Polyclonal HMGIY / HMGA1 Antibody
APG01093G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 . This antibody is tested and proven to work in the following applications:

Polyclonal Goat Anti-HMGA1 Antibody
APG00159G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 . This antibody is tested and proven to work in the following applications:

Polyclonal HMGIY / HMGA1 Antibody (Internal)
APG01040G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 (Internal). This antibody is tested and proven to work in the following applications:

Polyclonal HMGA1 Antibody (C-term)
APR06143G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGA1 (C-term). This antibody is tested and proven to work in the following applications:

HMGA1 Antibody
47493-100ul	SAB	100ul	EUR 252

HMGA1 Antibody
47751-100ul	SAB	100ul	EUR 252

HMGA1 Antibody
1-CSB-PA983341	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200

HMGA1 Antibody
1-CSB-PA230265	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

HMGA1 antibody
70R-51289	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal HMGA1 antibody

HMGA1 Antibody
AF5218	Affbiotech	200ul	EUR 304
Description: HMGA1 Antibody detects endogenous levels of total HMGA1.

HMGA1 Antibody
ABF5218	Lifescience Market	100 ug	EUR 438

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
DLR-HMGA1-c-48T	DL Develop	48T	EUR 570
Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
DLR-HMGA1-c-96T	DL Develop	96T	EUR 747
Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
DLR-HMGA1-Hu-48T	DL Develop	48T	EUR 517
Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
DLR-HMGA1-Hu-96T	DL Develop	96T	EUR 673
Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RDR-HMGA1-c-48Tests	Reddot Biotech	48 Tests	EUR 608

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RDR-HMGA1-c-96Tests	Reddot Biotech	96 Tests	EUR 847

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RDR-HMGA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RDR-HMGA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RD-HMGA1-c-48Tests	Reddot Biotech	48 Tests	EUR 581

Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RD-HMGA1-c-96Tests	Reddot Biotech	96 Tests	EUR 809

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RD-HMGA1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
RD-HMGA1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Polyclonal HMGIY / HMGA1 Antibody (aa1-53)
APR03322G	Leading Biology	0.05ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGIY / HMGA1 (aa1-53). This antibody is tested and proven to work in the following applications:

HMGA1 Conjugated Antibody
C47751	SAB	100ul	EUR 397

HMGA1 Conjugated Antibody
C47493	SAB	100ul	EUR 397

Anti-HMGA1 antibody
STJ28051	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.

Anti-HMGA1 antibody
STJ114566	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.

Anti-HMGA1 antibody
STJ193001	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to HMGA1

Anti-HMGA1 antibody
STJ70745	St John's Laboratory	100 µg	EUR 359

Hmga1/ Rat Hmga1 ELISA Kit
ELI-04846r	Lifescience Market	96 Tests	EUR 886

Polyclonal Goat Anti-HMGA1 (aa9-21) Antibody
APG00158G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 (aa9-21) . This antibody is tested and proven to work in the following applications:

HMGA1 siRNA
20-abx902480	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HMGA1 siRNA
20-abx919597	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

HMGA1 siRNA
20-abx919598	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Anti-HMGA1 (aa9-21) antibody
STJ71997	St John's Laboratory	100 µg	EUR 359

HMGA1 Blocking Peptide
20-abx064164	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

HMGA1 Blocking Peptide
AF5218-BP	Affbiotech	1mg	EUR 195

HMGA1 cloning plasmid
CSB-CL010545HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 291 Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccgaaggagcccagcgaagtgccaacacctaagagacctcggggccgaccaaagggaagcaaaaacaagggtgctgc Show more
Description: A cloning plasmid for the HMGA1 gene.

HMGA1 cloning plasmid
CSB-CL010545HU2-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 324 Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccggtgagtcccgggacagcgctggtagggagtcagaaggagcccagcgaagtgccaacacctaagagacctcgggg Show more
Description: A cloning plasmid for the HMGA1 gene.

HMGA1 protein (His tag)
80R-1896	Fitzgerald	50 ug	EUR 397
Description: Purified recombinant HMGA1 protein

Human HMGA1 ELISA Kit
ELA-E1478h	Lifescience Market	96 Tests	EUR 824

Canine HMGA1 ELISA KIT
ELI-04845d	Lifescience Market	96 Tests	EUR 928

HMGA1 ELISA KIT|Human
EF005799	Lifescience Market	96 Tests	EUR 689

Rat HMGA1 shRNA Plasmid
20-abx987402	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human HMGA1 shRNA Plasmid
20-abx952156	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse HMGA1 shRNA Plasmid
20-abx970825	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

HMGA1 Recombinant Protein (Human)
RP014968	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Human)
RP014971	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Rat)
RP204716	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141815	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141818	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141821	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141824	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141827	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141830	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141833	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141836	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141839	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141842	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141845	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141848	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141851	ABM	100 ug	Ask for price

HMGA1 Recombinant Protein (Mouse)
RP141854	ABM	100 ug	Ask for price

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human)
4-PAC050Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMGA1 (Glu3~Gln107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1)

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse)
4-PAC050Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMGA1 (Met1~Gln107) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1)

High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat)
4-PAC050Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: HMGA1 (Met1~Gln107) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1)

Hmga1 ORF Vector (Rat) (pORF)
ORF068240	ABM	1.0 ug DNA	EUR 506

HMGA1 ORF Vector (Human) (pORF)
ORF004990	ABM	1.0 ug DNA	EUR 95

HMGA1 ORF Vector (Human) (pORF)
ORF004991	ABM	1.0 ug DNA	EUR 95

Hmga1 ORF Vector (Mouse) (pORF)
ORF047273	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047274	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047275	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047276	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047277	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047278	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047279	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047280	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047281	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047282	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047283	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047284	ABM	1.0 ug DNA	EUR 506

Hmga1 ORF Vector (Mouse) (pORF)
ORF047285	ABM	1.0 ug DNA	EUR 506

HMGA1 Rabbit Polyclonal Antibody