HMGA1 Rabbit Polyclonal Antibody

HMGA1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    HMGA1 Polyclonal Antibody
    ES11843-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HMGA1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    HMGA1 Polyclonal Antibody
    ES11843-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HMGA1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    Polyclonal HMGIY / HMGA1 Antibody
    APG01093G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 . This antibody is tested and proven to work in the following applications:
    HMGA1 Rabbit pAb
    A1635-100ul 100 ul
    EUR 308
    HMGA1 Rabbit pAb
    A1635-200ul 200 ul
    EUR 459
    HMGA1 Rabbit pAb
    A1635-20ul 20 ul
    EUR 183
    HMGA1 Rabbit pAb
    A1635-50ul 50 ul
    EUR 223
    HMGA1 Rabbit pAb
    A12693-100ul 100 ul
    EUR 308
    HMGA1 Rabbit pAb
    A12693-200ul 200 ul
    EUR 459
    HMGA1 Rabbit pAb
    A12693-20ul 20 ul
    EUR 183
    HMGA1 Rabbit pAb
    A12693-50ul 50 ul
    EUR 223
    HMGA1 Rabbit mAb
    A4343-100ul 100 ul
    EUR 410
    HMGA1 Rabbit mAb
    A4343-200ul 200 ul
    EUR 571
    HMGA1 Rabbit mAb
    A4343-20ul 20 ul
    EUR 221
    HMGA1 Rabbit mAb
    A4343-50ul 50 ul
    EUR 287
    Polyclonal Goat Anti-HMGA1 Antibody
    APG00159G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 . This antibody is tested and proven to work in the following applications:
    Polyclonal HMGIY / HMGA1 Antibody (Internal)
    APG01040G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human HMGIY / HMGA1 (Internal). This antibody is tested and proven to work in the following applications:
    Polyclonal HMGA1 Antibody (C-term)
    APR06143G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGA1 (C-term). This antibody is tested and proven to work in the following applications:
    HMGA1 Antibody
    47493-100ul 100ul
    EUR 252
    HMGA1 Antibody
    47751-100ul 100ul
    EUR 252
    HMGA1 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
    HMGA1 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against HMGA1. Recognizes HMGA1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
    HMGA1 antibody
    70R-51289 100 ul
    EUR 244
    Description: Purified Polyclonal HMGA1 antibody
    HMGA1 Antibody
    AF5218 200ul
    EUR 304
    Description: HMGA1 Antibody detects endogenous levels of total HMGA1.
    HMGA1 Antibody
    ABF5218 100 ug
    EUR 438
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    DLR-HMGA1-c-48T 48T
    EUR 570
    • Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    DLR-HMGA1-c-96T 96T
    EUR 747
    • Should the Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Canine High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates or other biological fluids.
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    DLR-HMGA1-Hu-48T 48T
    EUR 517
    • Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    DLR-HMGA1-Hu-96T 96T
    EUR 673
    • Should the Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human High Mobility Group AT Hook Protein 1 (HMGA1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RDR-HMGA1-c-48Tests 48 Tests
    EUR 608
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RDR-HMGA1-c-96Tests 96 Tests
    EUR 847
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RDR-HMGA1-Hu-48Tests 48 Tests
    EUR 544
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RDR-HMGA1-Hu-96Tests 96 Tests
    EUR 756
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RD-HMGA1-c-48Tests 48 Tests
    EUR 581
    Canine High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RD-HMGA1-c-96Tests 96 Tests
    EUR 809
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RD-HMGA1-Hu-48Tests 48 Tests
    EUR 521
    Human High Mobility Group AT Hook Protein 1 (HMGA1) ELISA Kit
    RD-HMGA1-Hu-96Tests 96 Tests
    EUR 723
    Polyclonal HMGIY / HMGA1 Antibody (aa1-53)
    APR03322G 0.05ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human HMGIY / HMGA1 (aa1-53). This antibody is tested and proven to work in the following applications:
    HMGA1 Conjugated Antibody
    C47751 100ul
    EUR 397
    HMGA1 Conjugated Antibody
    C47493 100ul
    EUR 397
    Anti-HMGA1 antibody
    STJ28051 100 µl
    EUR 277
    Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.
    Anti-HMGA1 antibody
    STJ114566 100 µl
    EUR 277
    Description: This gene encodes a chromatin-associated protein involved in the regulation of gene transcription, integration of retroviruses into chromosomes, and the metastatic progression of cancer cells. The encoded protein preferentially binds to the minor groove of AT-rich regions in double-stranded DNA. Multiple transcript variants encoding different isoforms have been found for this gene. Pseudogenes of this gene have been identified on multiple chromosomes.
    Anti-HMGA1 antibody
    STJ193001 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to HMGA1
    Anti-HMGA1 antibody
    STJ70745 100 µg
    EUR 359
    Hmga1/ Rat Hmga1 ELISA Kit
    ELI-04846r 96 Tests
    EUR 886
    Polyclonal Goat Anti-HMGA1 (aa9-21) Antibody
    APG00158G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-HMGA1 (aa9-21) . This antibody is tested and proven to work in the following applications:
    HMGA1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    HMGA1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    HMGA1 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Anti-HMGA1 (aa9-21) antibody
    STJ71997 100 µg
    EUR 359
    HMGA1 Blocking Peptide
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    HMGA1 Blocking Peptide
    AF5218-BP 1mg
    EUR 195
    HMGA1 cloning plasmid
    CSB-CL010545HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 291
    • Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccgaaggagcccagcgaagtgccaacacctaagagacctcggggccgaccaaagggaagcaaaaacaagggtgctgc
    • Show more
    Description: A cloning plasmid for the HMGA1 gene.
    HMGA1 cloning plasmid
    CSB-CL010545HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 324
    • Sequence: atgagtgagtcgagctcgaagtccagccagcccttggcctccaagcaggaaaaggacggcactgagaagcggggccggggcaggccgcgcaagcagcctccggtgagtcccgggacagcgctggtagggagtcagaaggagcccagcgaagtgccaacacctaagagacctcgggg
    • Show more
    Description: A cloning plasmid for the HMGA1 gene.
    HMGA1 protein (His tag)
    80R-1896 50 ug
    EUR 397
    Description: Purified recombinant HMGA1 protein
    Human HMGA1 ELISA Kit
    ELA-E1478h 96 Tests
    EUR 824
    Canine HMGA1 ELISA KIT
    ELI-04845d 96 Tests
    EUR 928
    EF005799 96 Tests
    EUR 689
    Rat HMGA1 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human HMGA1 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse HMGA1 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    HMGA1 Recombinant Protein (Human)
    RP014968 100 ug Ask for price
    HMGA1 Recombinant Protein (Human)
    RP014971 100 ug Ask for price
    HMGA1 Recombinant Protein (Rat)
    RP204716 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141815 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141818 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141821 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141824 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141827 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141830 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141833 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141836 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141839 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141842 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141845 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141848 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141851 100 ug Ask for price
    HMGA1 Recombinant Protein (Mouse)
    RP141854 100 ug Ask for price
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human)
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1)
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse)
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1)
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat)
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1)
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), Biotinylated
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Human), PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Glu3~Gln107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), Biotinylated
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with HRP.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Mouse), PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with PE.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with APC.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), Biotinylated
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Biotin.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with Cy3.
    High Mobility Group AT Hook Protein 1 (HMGA1) Polyclonal Antibody (Rat), FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: HMGA1 (Met1~Gln107)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat High Mobility Group AT Hook Protein 1 (HMGA1). This antibody is labeled with FITC.

    HMGA1 Rabbit Polyclonal Antibody