GPR64 Rabbit Polyclonal Antibody

GPR64 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GPR64 Antibody
    ABD2758 100 ug
    EUR 438
    GPR64 Antibody
    36911-100ul 100ul
    EUR 252
    GPR64 Antibody
    1-CSB-PA912224
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against GPR64. Recognizes GPR64 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:50-1:200
    GPR64 Antibody
    DF2758 200ul
    EUR 304
    Description: GPR64 antibody detects endogenous levels of total GPR64.
    Gpr64/ Rat Gpr64 ELISA Kit
    ELI-31709r 96 Tests
    EUR 886
    Polyclonal ADGRG2 / GPR64 Antibody (C-Terminus)
    APR14845G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human ADGRG2 / GPR64 (C-Terminus). This antibody is tested and proven to work in the following applications:
    GPR64 Conjugated Antibody
    C36911 100ul
    EUR 397
    Anti-GPR64 antibody
    STJ192657 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GPR64
    GPR64 siRNA
    20-abx902288
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GPR64 siRNA
    20-abx918545
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GPR64 siRNA
    20-abx918546
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    GPR64 Blocking Peptide
    DF2758-BP 1mg
    EUR 195
    GPR64 cloning plasmid
    CSB-CL811638HU-10ug 10ug
    EUR 558
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2853
    • Sequence: ATGGTTTTCTCTGTCAGGCAGTGTGGCCATGTTGGCAGAACTGAAGAAGTTTTACTGACGTTCAAGATATTCCTTGTCATCATTTGTCTTCATGTCGTTCTGGTAACATCCCTGGAAGAAGATACTGATAATTCCAGTTTGTCACCACCACCTGAGGTTGAAACAACAAGCCTCA
    • Show more
    Description: A cloning plasmid for the GPR64 gene.
    Rat GPR64 shRNA Plasmid
    20-abx988100
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human GPR64 shRNA Plasmid
    20-abx956849
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse GPR64 shRNA Plasmid
    20-abx982267
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    G-Protein Coupled Receptor 64 (GPR64) Antibody
    abx147547-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.
    Gpr64 ORF Vector (Rat) (pORF)
    ORF067819 1.0 ug DNA
    EUR 506
    Gpr64 ORF Vector (Mouse) (pORF)
    ORF046562 1.0 ug DNA
    EUR 506
    Gpr64 ORF Vector (Mouse) (pORF)
    ORF046563 1.0 ug DNA
    EUR 506
    Gpr64 ORF Vector (Mouse) (pORF)
    ORF046564 1.0 ug DNA
    EUR 506
    Gpr64 ORF Vector (Mouse) (pORF)
    ORF046565 1.0 ug DNA
    EUR 506
    GPR64 ORF Vector (Human) (pORF)
    ORF013198 1.0 ug DNA
    EUR 354
    GPR64 sgRNA CRISPR Lentivector set (Human)
    K0892501 3 x 1.0 ug
    EUR 339
    Gpr64 sgRNA CRISPR Lentivector set (Mouse)
    K4391901 3 x 1.0 ug
    EUR 339
    Gpr64 sgRNA CRISPR Lentivector set (Rat)
    K7196001 3 x 1.0 ug
    EUR 339
    GPR64 sgRNA CRISPR Lentivector (Human) (Target 1)
    K0892502 1.0 ug DNA
    EUR 154
    GPR64 sgRNA CRISPR Lentivector (Human) (Target 2)
    K0892503 1.0 ug DNA
    EUR 154
    GPR64 sgRNA CRISPR Lentivector (Human) (Target 3)
    K0892504 1.0 ug DNA
    EUR 154
    Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4391902 1.0 ug DNA
    EUR 154
    Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4391903 1.0 ug DNA
    EUR 154
    Gpr64 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4391904 1.0 ug DNA
    EUR 154
    Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7196002 1.0 ug DNA
    EUR 154
    Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7196003 1.0 ug DNA
    EUR 154
    Gpr64 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7196004 1.0 ug DNA
    EUR 154
    GPR64 Protein Vector (Human) (pPB-C-His)
    PV052789 500 ng
    EUR 481
    GPR64 Protein Vector (Human) (pPB-N-His)
    PV052790 500 ng
    EUR 481
    GPR64 Protein Vector (Human) (pPM-C-HA)
    PV052791 500 ng
    EUR 481
    GPR64 Protein Vector (Human) (pPM-C-His)
    PV052792 500 ng
    EUR 481
    GPR64 Protein Vector (Rat) (pPB-C-His)
    PV271274 500 ng
    EUR 1191
    GPR64 Protein Vector (Rat) (pPB-N-His)
    PV271275 500 ng
    EUR 1191
    GPR64 Protein Vector (Rat) (pPM-C-HA)
    PV271276 500 ng
    EUR 1191
    GPR64 Protein Vector (Rat) (pPM-C-His)
    PV271277 500 ng
    EUR 1191
    GPR64 Protein Vector (Mouse) (pPB-C-His)
    PV186246 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPB-N-His)
    PV186247 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPM-C-HA)
    PV186248 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPM-C-His)
    PV186249 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPB-C-His)
    PV186250 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPB-N-His)
    PV186251 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPM-C-HA)
    PV186252 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPM-C-His)
    PV186253 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPB-C-His)
    PV186254 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPB-N-His)
    PV186255 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPM-C-HA)
    PV186256 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPM-C-His)
    PV186257 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPB-C-His)
    PV186258 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPB-N-His)
    PV186259 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPM-C-HA)
    PV186260 500 ng
    EUR 1065
    GPR64 Protein Vector (Mouse) (pPM-C-His)
    PV186261 500 ng
    EUR 1065
    Gpr64 3'UTR Luciferase Stable Cell Line
    TU205387 1.0 ml Ask for price
    Gpr64 3'UTR GFP Stable Cell Line
    TU159037 1.0 ml Ask for price
    GPR64 3'UTR Luciferase Stable Cell Line
    TU009176 1.0 ml
    EUR 2333
    Gpr64 3'UTR Luciferase Stable Cell Line
    TU109037 1.0 ml Ask for price
    GPR64 3'UTR GFP Stable Cell Line
    TU059176 1.0 ml
    EUR 2333
    Gpr64 3'UTR GFP Stable Cell Line
    TU255387 1.0 ml Ask for price
    GPR64 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
    LV628903 1.0 ug DNA
    EUR 1355
    GPR64 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
    LV628907 1.0 ug DNA
    EUR 1355
    GPR64 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
    LV628908 1.0 ug DNA
    EUR 1355
    VEGF Rabbit Polyclonal Antibody
    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    VEGF Rabbit Polyclonal Antibody
    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    HSC70 Rabbit Polyclonal Antibody
    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSC70 Rabbit Polyclonal Antibody
    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP40 Rabbit Polyclonal Antibody
    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP40 Rabbit Polyclonal Antibody
    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP90? Rabbit Polyclonal Antibody
    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    HSP90? Rabbit Polyclonal Antibody
    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    IkB ? Rabbit Polyclonal Antibody
    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    IkB ? Rabbit Polyclonal Antibody
    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    JAK1 Rabbit Polyclonal Antibody
    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK1 Rabbit Polyclonal Antibody
    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK2 Rabbit Polyclonal Antibody
    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK2 Rabbit Polyclonal Antibody
    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    GPR64 Rabbit Polyclonal Antibody