MATR3 Rabbit Polyclonal Antibody

MATR3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

MATR3 Polyclonal Antibody
ES11773-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MATR3. This antibody is tested and validated for WB, ELISA, WB, ELISA

MATR3 Polyclonal Antibody
ES11773-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MATR3. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Matrin 3 (MATR3) ELISA Kit
DLR-MATR3-Hu-48T	DL Develop	48T	EUR 517
Should the Human Matrin 3 (MATR3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrin 3 (MATR3) in samples from tissue homogenates or other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit
DLR-MATR3-Hu-96T	DL Develop	96T	EUR 673
Should the Human Matrin 3 (MATR3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Matrin 3 (MATR3) in samples from tissue homogenates or other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit
RDR-MATR3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Matrin 3 (MATR3) ELISA Kit
RDR-MATR3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Matrin 3 (MATR3) ELISA Kit
RD-MATR3-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Matrin 3 (MATR3) ELISA Kit
RD-MATR3-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

MATR3 Rabbit pAb
A5905-100ul	Abclonal	100 ul	EUR 308

MATR3 Rabbit pAb
A5905-200ul	Abclonal	200 ul	EUR 459

MATR3 Rabbit pAb
A5905-20ul	Abclonal	20 ul	EUR 183

MATR3 Rabbit pAb
A5905-50ul	Abclonal	50 ul	EUR 223

MATR3 antibody
70R-18424	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal MATR3 antibody

MATR3 Antibody
36602-100ul	SAB	100ul	EUR 252

MATR3 antibody
10R-1442	Fitzgerald	50 ug	EUR 242
Description: Mouse monoclonal MATR3 antibody

MATR3 antibody
10R-10395	Fitzgerald	100 ug	EUR 435
Description: Mouse monoclonal MATR3 antibody

MATR3 Antibody
1-CSB-PA125471	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

MATR3 Antibody
1-CSB-PA272764	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

MATR3 Antibody
1-CSB-PA013525GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MATR3. Recognizes MATR3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MATR3 Conjugated Antibody
C36602	SAB	100ul	EUR 397

anti- MATR3 antibody
FNab05030	FN Test	100µg	EUR 548.75
Immunogen: matrin 3 Uniprot ID: P43243 Gene ID: 9782 Research Area: Neuroscience
Description: Antibody raised against MATR3

Anti-MATR3 antibody
PAab05030	Lifescience Market	100 ug	EUR 386

Anti-MATR3 antibody
STJ117820	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X.

Anti-MATR3 antibody
STJ192931	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MATR3

Matr3/ Rat Matr3 ELISA Kit
ELI-15737r	Lifescience Market	96 Tests	EUR 886

MATR3 siRNA
20-abx903173	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MATR3 siRNA
20-abx923628	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MATR3 siRNA
20-abx923629	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody
abx018181-100ug	Abbexa	100 ug	EUR 342
Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody
20-abx177463	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Matrin 3 (MATR3) Antibody
20-abx213465	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody
20-abx213466	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody
20-abx113617	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Matrin 3 (MATR3) Antibody
20-abx173467	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Matrin 3 (MATR3) Antibody
abx235030-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

MATR3 cloning plasmid
CSB-CL013525HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2544 Sequence: atgtccaagtcattccagcagtcatctctcagtagggactcacagggtcatgggcgtgacctgtctgcggcaggaataggccttcttgctgctgctacccagtctttaagtatgccagcatctcttggaaggatgaaccagggtactgcacgccttgctagtttaatgaatcttg Show more
Description: A cloning plasmid for the MATR3 gene.

pCMV-SPORT6-MATR3
PVT13174	Lifescience Market	2 ug	EUR 391

MATR3 ELISA KIT|Human
EF010852	Lifescience Market	96 Tests	EUR 689

Rat MATR3 shRNA Plasmid
20-abx985315	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MATR3 shRNA Plasmid
20-abx956544	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MATR3 shRNA Plasmid
20-abx971445	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Matrin 3 (MATR3) Protein
20-abx654280	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Matr3 ORF Vector (Rat) (pORF)
ORF070324	ABM	1.0 ug DNA	EUR 506

MATR3 ORF Vector (Human) (pORF)
ORF006294	ABM	1.0 ug DNA	EUR 95

Matr3 ORF Vector (Mouse) (pORF)
ORF049866	ABM	1.0 ug DNA	EUR 506

MATR3 ELISA Kit (Human) (OKCD01966)
OKCD01966	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: May play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. In association with the SFPQ-NONO heteromer may play a role in nuclear retention of defective RNAs.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL

Human Matrin-3(MATR3) ELISA kit
CSB-EL013525HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3 (MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Matrin-3(MATR3) ELISA kit
1-CSB-EL013525HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Matrin-3(MATR3) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Matrin 3 (MATR3) ELISA Kit
20-abx152280	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Matrin- 3, MATR3 ELISA KIT
ELI-15736h	Lifescience Market	96 Tests	EUR 824

Mouse Matrin- 3, Matr3 ELISA KIT
ELI-19577m	Lifescience Market	96 Tests	EUR 865

Rat Matrin 3 (MATR3) ELISA Kit
abx391583-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Matrin 3 (MATR3) CLIA Kit
20-abx495516	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Matrin 3 (MATR3) ELISA Kit
abx389823-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Matr3 sgRNA CRISPR Lentivector set (Rat)
K6863001	ABM	3 x 1.0 ug	EUR 339

MATR3 sgRNA CRISPR Lentivector set (Human)
K1273601	ABM	3 x 1.0 ug	EUR 339

MATR3 sgRNA CRISPR Lentivector set (Human)
K2822501	ABM	3 x 1.0 ug	EUR 339

Matr3 sgRNA CRISPR Lentivector set (Mouse)
K4726501	ABM	3 x 1.0 ug	EUR 339

Human Matrin 3(MATR3)ELISA Kit
QY-E04807	Qayee Biotechnology	96T	EUR 361

Human Matrin 3 (MATR3) ELISA Kit
SEH678Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit
SEH678Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit
SEH678Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit
SEH678Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Matrin 3 (MATR3) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Matrin 3 (MATR3) in Tissue homogenates and other biological fluids.

Human Matrin 3 (MATR3) ELISA Kit
4-SEH678Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Matrin 3 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Matrin 3 (MATR3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Human MATR3 (Matrin 3)
ELK4592	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Matrin 3 (MATR3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Matrin 3 (MATR3). Show more
Description: A sandwich ELISA kit for detection of Matrin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Matrin-3 (MATR3)
KTE100657-48T	Abbkine	48T	EUR 332
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Matrin-3 (MATR3)
KTE100657-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Matrin-3 (MATR3)
KTE100657-96T	Abbkine	96T	EUR 539
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Rat Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Matr3 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6863002	ABM	1.0 ug DNA	EUR 154

Matr3 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6863003	ABM	1.0 ug DNA	EUR 154

Matr3 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6863004	ABM	1.0 ug DNA	EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 1)
K1273602	ABM	1.0 ug DNA	EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 2)
K1273603	ABM	1.0 ug DNA	EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 3)
K1273604	ABM	1.0 ug DNA	EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 1)
K2822502	ABM	1.0 ug DNA	EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 2)
K2822503	ABM	1.0 ug DNA	EUR 154

MATR3 sgRNA CRISPR Lentivector (Human) (Target 3)
K2822504	ABM	1.0 ug DNA	EUR 154

ELISA kit for Mouse Matrin-3 (MATR3)
KTE71110-48T	Abbkine	48T	EUR 332
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrin-3 (MATR3)
KTE71110-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Matrin-3 (MATR3)
KTE71110-96T	Abbkine	96T	EUR 539
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Mouse Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrin-3 (MATR3)
KTE61708-48T	Abbkine	48T	EUR 332
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrin-3 (MATR3)
KTE61708-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Matrin-3 (MATR3)
KTE61708-96T	Abbkine	96T	EUR 539
Matrin 3(MATR3) is localized in the nuclear matrix. It may play a role in transcription or may interact with other nuclear matrix proteins to form the internal fibrogranular network. Two transcript variants encoding the same protein have been identif Show more
Description: Quantitative sandwich ELISA for measuring Human Matrin-3 (MATR3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4726502	ABM	1.0 ug DNA	EUR 154

Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4726503	ABM	1.0 ug DNA	EUR 154

Matr3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4726504	ABM	1.0 ug DNA	EUR 154

MATR3 Protein Vector (Human) (pPB-C-His)
PV025173	ABM	500 ng	EUR 329

MATR3 Protein Vector (Human) (pPB-N-His)
PV025174	ABM	500 ng	EUR 329

MATR3 Protein Vector (Human) (pPM-C-HA)
PV025175	ABM	500 ng	EUR 329

MATR3 Protein Vector (Human) (pPM-C-His)
PV025176	ABM	500 ng	EUR 329

MATR3 Protein Vector (Rat) (pPB-C-His)
PV281294	ABM	500 ng	EUR 1166

MATR3 Protein Vector (Rat) (pPB-N-His)
PV281295	ABM	500 ng	EUR 1166

MATR3 Protein Vector (Rat) (pPM-C-HA)
PV281296	ABM	500 ng	EUR 1166

MATR3 Protein Vector (Rat) (pPM-C-His)
PV281297	ABM	500 ng	EUR 1166

MATR3 Protein Vector (Mouse) (pPB-C-His)
PV199462	ABM	500 ng	EUR 1065

MATR3 Protein Vector (Mouse) (pPB-N-His)
PV199463	ABM	500 ng	EUR 1065

MATR3 Protein Vector (Mouse) (pPM-C-HA)
PV199464	ABM	500 ng	EUR 1065

MATR3 Rabbit Polyclonal Antibody