ELN Rabbit Polyclonal Antibody

ELN Rabbit Polyclonal Antibody

Contact Us Below To Order :

    Rat Elastin (ELN) ELISA Kit

    DLR-ELN-Ra-96T 96T
    EUR 690
    • Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids.

    Human Elastin (ELN) ELISA Kit

    RDR-ELN-Hu-48Tests 48 Tests
    EUR 522

    Human Elastin (ELN) ELISA Kit

    RDR-ELN-Hu-96Tests 96 Tests
    EUR 724

    Mouse Elastin (ELN) ELISA Kit

    RDR-ELN-Mu-48Tests 48 Tests
    EUR 534

    Mouse Elastin (ELN) ELISA Kit

    RDR-ELN-Mu-96Tests 96 Tests
    EUR 742

    Rat Elastin (ELN) ELISA Kit

    RDR-ELN-Ra-48Tests 48 Tests
    EUR 558

    Rat Elastin (ELN) ELISA Kit

    RDR-ELN-Ra-96Tests 96 Tests
    EUR 776

    Human Elastin (ELN) ELISA Kit

    RD-ELN-Hu-48Tests 48 Tests
    EUR 500

    Human Elastin (ELN) ELISA Kit

    RD-ELN-Hu-96Tests 96 Tests
    EUR 692

    Mouse Elastin (ELN) ELISA Kit

    RD-ELN-Mu-48Tests 48 Tests
    EUR 511

    Mouse Elastin (ELN) ELISA Kit

    RD-ELN-Mu-96Tests 96 Tests
    EUR 709

    Rat Elastin (ELN) ELISA Kit

    RD-ELN-Ra-48Tests 48 Tests
    EUR 534

    Rat Elastin (ELN) ELISA Kit

    RD-ELN-Ra-96Tests 96 Tests
    EUR 742

    ELN Polyclonal Antibody

    ABP58473-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human ELN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

    ELN Polyclonal Antibody

    ABP58473-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human ELN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

    ELN Polyclonal Antibody

    ABP58473-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human ELN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

    ELN Polyclonal Antibody

    ES11837-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ELN Polyclonal Antibody

    ES11837-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ELN Rabbit pAb

    A12433-100ul 100 ul
    EUR 308

    ELN Rabbit pAb

    A12433-200ul 200 ul
    EUR 459

    ELN Rabbit pAb

    A12433-20ul 20 ul
    EUR 183

    ELN Rabbit pAb

    A12433-50ul 50 ul
    EUR 223

    ELN Rabbit pAb

    A2723-100ul 100 ul
    EUR 308

    ELN Rabbit pAb

    A2723-200ul 200 ul
    EUR 459

    ELN Rabbit pAb

    A2723-20ul 20 ul
    EUR 183

    ELN Rabbit pAb

    A2723-50ul 50 ul
    EUR 223

    Elastin (ELN) Polyclonal Antibody (Human)

    4-PAB337Hu01
    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

    Elastin (ELN) Polyclonal Antibody (Human)

    4-PAB337Hu08
    • EUR 253.00
    • EUR 2615.00
    • EUR 649.00
    • EUR 319.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

    Elastin (ELN) Polyclonal Antibody (Mouse)

    4-PAB337Mu01
    • EUR 243.00
    • EUR 2457.00
    • EUR 613.00
    • EUR 305.00
    • EUR 212.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN)

    Rabbit ELN ELISA Kit

    ERTE0057 96Tests
    EUR 521

    ELN Antibody

    35724-100ul 100ul
    EUR 252

    ELN antibody

    38448-100ul 100ul
    EUR 252

    ELN Antibody

    DF7064 200ul
    EUR 304
    Description: ELN Antibody detects endogenous levels of total ELN.

    ELN Antibody

    1-CSB-PA583825
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

    ELN Antibody

    1-CSB-PA591479
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

    ELN Antibody

    ABD7064 100 ug
    EUR 438

    Elastin (ELN) Polyclonal Antibody (Human), APC

    4-PAB337Hu01-APC
    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

    Elastin (ELN) Polyclonal Antibody (Human), Biotinylated

    4-PAB337Hu01-Biotin
    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

    Elastin (ELN) Polyclonal Antibody (Human), Cy3

    4-PAB337Hu01-Cy3
    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

    Elastin (ELN) Polyclonal Antibody (Human), FITC

    4-PAB337Hu01-FITC
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

    Elastin (ELN) Polyclonal Antibody (Human), HRP

    4-PAB337Hu01-HRP
    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

    Elastin (ELN) Polyclonal Antibody (Human), PE

    4-PAB337Hu01-PE
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

    Elastin (ELN) Polyclonal Antibody (Human), APC

    4-PAB337Hu08-APC
    • EUR 355.00
    • EUR 3419.00
    • EUR 948.00
    • EUR 454.00
    • EUR 224.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

    Elastin (ELN) Polyclonal Antibody (Human), Biotinylated

    4-PAB337Hu08-Biotin
    • EUR 318.00
    • EUR 2565.00
    • EUR 753.00
    • EUR 391.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

    Elastin (ELN) Polyclonal Antibody (Human), Cy3

    4-PAB337Hu08-Cy3
    • EUR 432.00
    • EUR 4517.00
    • EUR 1223.00
    • EUR 564.00
    • EUR 257.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

    Elastin (ELN) Polyclonal Antibody (Human), FITC

    4-PAB337Hu08-FITC
    • EUR 304.00
    • EUR 2755.00
    • EUR 778.00
    • EUR 383.00
    • EUR 199.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

    Elastin (ELN) Polyclonal Antibody (Human), HRP

    4-PAB337Hu08-HRP
    • EUR 324.00
    • EUR 2979.00
    • EUR 838.00
    • EUR 410.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

    Elastin (ELN) Polyclonal Antibody (Human), PE

    4-PAB337Hu08-PE
    • EUR 304.00
    • EUR 2755.00
    • EUR 778.00
    • EUR 383.00
    • EUR 199.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

    Elastin (ELN) Polyclonal Antibody (Mouse), APC

    4-PAB337Mu01-APC
    • EUR 340.00
    • EUR 3203.00
    • EUR 894.00
    • EUR 432.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC.

    Elastin (ELN) Polyclonal Antibody (Mouse), Biotinylated

    4-PAB337Mu01-Biotin
    • EUR 307.00
    • EUR 2407.00
    • EUR 714.00
    • EUR 375.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Biotin.

    Elastin (ELN) Polyclonal Antibody (Mouse), Cy3

    4-PAB337Mu01-Cy3
    • EUR 411.00
    • EUR 4229.00
    • EUR 1151.00
    • EUR 535.00
    • EUR 248.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Cy3.

    Elastin (ELN) Polyclonal Antibody (Mouse), FITC

    4-PAB337Mu01-FITC
    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with FITC.

    Elastin (ELN) Polyclonal Antibody (Mouse), HRP

    4-PAB337Mu01-HRP
    • EUR 311.00
    • EUR 2792.00
    • EUR 791.00
    • EUR 391.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with HRP.

    Elastin (ELN) Polyclonal Antibody (Mouse), PE

    4-PAB337Mu01-PE
    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with PE.

    Rabbit Elastin (ELN) ELISA Kit

    abx354258-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Elastin (ELN) Antibody

    20-abx007872
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody

    20-abx176238
    • EUR 1177.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Elastin (ELN) Antibody

    20-abx176239
    • EUR 1247.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Elastin (ELN) Antibody

    20-abx211321
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody

    20-abx100085
    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody

    20-abx100086
    • EUR 425.00
    • EUR 133.00
    • EUR 1177.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody

    20-abx100087
    • EUR 829.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Elastin (ELN) Antibody

    20-abx132104
    • EUR 328.00
    • EUR 815.00
    • EUR 425.00
    • EUR 154.00
    • EUR 258.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody

    20-abx132220
    • EUR 439.00
    • EUR 133.00
    • EUR 1261.00
    • EUR 606.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody

    20-abx146903
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody

    20-abx172209
    • EUR 871.00
    • EUR 453.00
    • 1 mg
    • 200 ug
    • Please enquire.

    ELN Conjugated Antibody

    C35724 100ul
    EUR 397

    ELN Conjugated Antibody

    C38448 100ul
    EUR 397

    Elastin (ELN) Antibody

    20-abx339544
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody

    20-abx002068
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anti-ELN antibody

    STJ114307 100 µl
    EUR 277
    Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

    Anti-ELN antibody

    STJ192995 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ELN

    Anti-ELN antibody

    STJ23529 100 µl
    EUR 277
    Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

    ELN/ Rat ELN ELISA Kit

    ELA-E1337r 96 Tests
    EUR 886

    Eln/ Rat Eln ELISA Kit

    ELI-04404r 96 Tests
    EUR 886

    Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7

    4-PAB337Hu01-APC-Cy7
    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

    Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7

    4-PAB337Hu08-APC-Cy7
    • EUR 590.00
    • EUR 6718.00
    • EUR 1777.00
    • EUR 788.00
    • EUR 328.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

    Elastin (ELN) Polyclonal Antibody (Mouse), APC-Cy7

    4-PAB337Mu01-APC-Cy7
    • EUR 560.00
    • EUR 6286.00
    • EUR 1669.00
    • EUR 745.00
    • EUR 315.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC-Cy7.

    ELISA kit for Rabbit ELN (Elastin)

    E-EL-RB0506 1 plate of 96 wells
    EUR 584
    • Gentaur's ELN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rabbit ELN. Standards or samples are added to the micro ELISA plate wells and combined with the
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Rabbit ELN (Elastin) in samples from Serum, Plasma, Cell supernatant

    ELN siRNA

    20-abx901701
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ELN siRNA

    20-abx915285
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ELN siRNA

    20-abx915286
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ELN-441958

    HY-15043 10mg
    EUR 739

    Elastin (ELN) Antibody (FITC)

    20-abx271077
    • EUR 467.00
    • EUR 244.00
    • EUR 1386.00
    • EUR 648.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Elastin (ELN) Antibody (Biotin)

    20-abx271340
    • EUR 453.00
    • EUR 244.00
    • EUR 1288.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Elastin (ELN) Antibody (Biotin)

    20-abx272127
    • EUR 439.00
    • EUR 244.00
    • EUR 1261.00
    • EUR 606.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody Pair

    20-abx370672
    • EUR 1664.00
    • EUR 1066.00
    • 10 × 96 tests
    • 5 × 96 tests
    • Shipped within 5-15 working days.

    Elastin (ELN) Antibody (FITC)

    20-abx273707
    • EUR 467.00
    • EUR 244.00
    • EUR 1358.00
    • EUR 648.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Elastin (ELN) Monoclonal Antibody (Human)

    4-MAB337Hu21
    • EUR 247.00
    • EUR 2523.00
    • EUR 628.00
    • EUR 311.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN)

    ELN Blocking Peptide

    DF7064-BP 1mg
    EUR 195

    ELN cloning plasmid

    CSB-CL007617HU-10ug 10ug
    EUR 663
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1977
    • Sequence: atggcgggtctgacggcggcggccccgcggcccggagtcctcctgctcctgctgtccatcctccacccctctcggcctggaggggtccctggggccattcctggtggagttcctggaggagtcttttatccaggggctggtctcggagcccttggaggaggagcgctggggcctg
    • Show more
    Description: A cloning plasmid for the ELN gene.

    ELN 318463 racemate

    HY-50882A 5mg
    EUR 601

    Recombinant Elastin (ELN)

    4-RPB337Hu01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P15502
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 22.9kDa
    • Isoelectric Point: 10.3
    Description: Recombinant Human Elastin expressed in: E.coli

    Recombinant Elastin (ELN)

    4-RPB337Mu01
    • EUR 499.62
    • EUR 236.00
    • EUR 1598.56
    • EUR 599.52
    • EUR 1099.04
    • EUR 397.00
    • EUR 3846.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P54320
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 47.3kDa
    • Isoelectric Point: 9
    Description: Recombinant Mouse Elastin expressed in: E.coli

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNUB1981-100 100uL
    EUR 264
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL

    ELN Rabbit Polyclonal Antibody