ELN Rabbit Polyclonal Antibody

ELN Rabbit Polyclonal Antibody

Contact Us Below To Order :

    Rat Elastin (ELN) ELISA Kit

    DLR-ELN-Ra-96T 96T
    EUR 690
    • Should the Rat Elastin (ELN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Elastin (ELN) in samples from serum, plasma or other biological fluids.

    Human Elastin (ELN) ELISA Kit

    RD-ELN-Hu-48Tests 48 Tests
    EUR 500

    Human Elastin (ELN) ELISA Kit

    RD-ELN-Hu-96Tests 96 Tests
    EUR 692

    Mouse Elastin (ELN) ELISA Kit

    RD-ELN-Mu-48Tests 48 Tests
    EUR 511

    Mouse Elastin (ELN) ELISA Kit

    RD-ELN-Mu-96Tests 96 Tests
    EUR 709

    Rat Elastin (ELN) ELISA Kit

    RD-ELN-Ra-48Tests 48 Tests
    EUR 534

    Rat Elastin (ELN) ELISA Kit

    RD-ELN-Ra-96Tests 96 Tests
    EUR 742

    Human Elastin (ELN) ELISA Kit

    RDR-ELN-Hu-48Tests 48 Tests
    EUR 522

    Human Elastin (ELN) ELISA Kit

    RDR-ELN-Hu-96Tests 96 Tests
    EUR 724

    Mouse Elastin (ELN) ELISA Kit

    RDR-ELN-Mu-48Tests 48 Tests
    EUR 534

    Mouse Elastin (ELN) ELISA Kit

    RDR-ELN-Mu-96Tests 96 Tests
    EUR 742

    Rat Elastin (ELN) ELISA Kit

    RDR-ELN-Ra-48Tests 48 Tests
    EUR 558

    Rat Elastin (ELN) ELISA Kit

    RDR-ELN-Ra-96Tests 96 Tests
    EUR 776

    ELN Polyclonal Antibody

    ES11837-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ELN Polyclonal Antibody

    ES11837-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ELN from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    ELN Polyclonal Antibody

    ABP58473-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human ELN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

    ELN Polyclonal Antibody

    ABP58473-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human ELN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

    ELN Polyclonal Antibody

    ABP58473-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human ELN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ELN from Human. This ELN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ELN protein

    ELN Rabbit pAb

    A12433-100ul 100 ul
    EUR 308

    ELN Rabbit pAb

    A12433-200ul 200 ul
    EUR 459

    ELN Rabbit pAb

    A12433-20ul 20 ul
    EUR 183

    ELN Rabbit pAb

    A12433-50ul 50 ul
    EUR 223

    ELN Rabbit pAb

    A2723-100ul 100 ul
    EUR 308

    ELN Rabbit pAb

    A2723-200ul 200 ul
    EUR 459

    ELN Rabbit pAb

    A2723-20ul 20 ul
    EUR 183

    ELN Rabbit pAb

    A2723-50ul 50 ul
    EUR 223

    Elastin (ELN) Polyclonal Antibody (Human)

    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

    Elastin (ELN) Polyclonal Antibody (Human)

    • EUR 253.00
    • EUR 2615.00
    • EUR 649.00
    • EUR 319.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN)

    Elastin (ELN) Polyclonal Antibody (Mouse)

    • EUR 243.00
    • EUR 2457.00
    • EUR 613.00
    • EUR 305.00
    • EUR 212.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN)

    Rabbit ELN ELISA Kit

    ERTE0057 96Tests
    EUR 521

    ELN Antibody

    ABD7064 100 ug
    EUR 438

    ELN Antibody

    35724-100ul 100ul
    EUR 252

    ELN antibody

    38448-100ul 100ul
    EUR 252

    ELN Antibody

    DF7064 200ul
    EUR 304
    Description: ELN Antibody detects endogenous levels of total ELN.

    ELN Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000

    ELN Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against ELN. Recognizes ELN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:50-1:200

    Elastin (ELN) Polyclonal Antibody (Human), APC

    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

    Elastin (ELN) Polyclonal Antibody (Human), Biotinylated

    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

    Elastin (ELN) Polyclonal Antibody (Human), Cy3

    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

    Elastin (ELN) Polyclonal Antibody (Human), FITC

    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

    Elastin (ELN) Polyclonal Antibody (Human), HRP

    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

    Elastin (ELN) Polyclonal Antibody (Human), PE

    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

    Elastin (ELN) Polyclonal Antibody (Human), APC

    • EUR 355.00
    • EUR 3419.00
    • EUR 948.00
    • EUR 454.00
    • EUR 224.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

    Elastin (ELN) Polyclonal Antibody (Human), Biotinylated

    • EUR 318.00
    • EUR 2565.00
    • EUR 753.00
    • EUR 391.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

    Elastin (ELN) Polyclonal Antibody (Human), Cy3

    • EUR 432.00
    • EUR 4517.00
    • EUR 1223.00
    • EUR 564.00
    • EUR 257.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

    Elastin (ELN) Polyclonal Antibody (Human), FITC

    • EUR 304.00
    • EUR 2755.00
    • EUR 778.00
    • EUR 383.00
    • EUR 199.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

    Elastin (ELN) Polyclonal Antibody (Human), HRP

    • EUR 324.00
    • EUR 2979.00
    • EUR 838.00
    • EUR 410.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

    Elastin (ELN) Polyclonal Antibody (Human), PE

    • EUR 304.00
    • EUR 2755.00
    • EUR 778.00
    • EUR 383.00
    • EUR 199.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

    Elastin (ELN) Polyclonal Antibody (Mouse), APC

    • EUR 340.00
    • EUR 3203.00
    • EUR 894.00
    • EUR 432.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC.

    Elastin (ELN) Polyclonal Antibody (Mouse), Biotinylated

    • EUR 307.00
    • EUR 2407.00
    • EUR 714.00
    • EUR 375.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Biotin.

    Elastin (ELN) Polyclonal Antibody (Mouse), Cy3

    • EUR 411.00
    • EUR 4229.00
    • EUR 1151.00
    • EUR 535.00
    • EUR 248.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with Cy3.

    Elastin (ELN) Polyclonal Antibody (Mouse), FITC

    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with FITC.

    Elastin (ELN) Polyclonal Antibody (Mouse), HRP

    • EUR 311.00
    • EUR 2792.00
    • EUR 791.00
    • EUR 391.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with HRP.

    Elastin (ELN) Polyclonal Antibody (Mouse), PE

    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with PE.

    Rabbit Elastin (ELN) ELISA Kit

    abx354258-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    ELN Conjugated Antibody

    C38448 100ul
    EUR 397

    ELN Conjugated Antibody

    C35724 100ul
    EUR 397

    Elastin (ELN) Antibody

    • EUR 328.00
    • EUR 815.00
    • EUR 425.00
    • EUR 154.00
    • EUR 258.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody

    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody

    • EUR 439.00
    • EUR 133.00
    • EUR 1261.00
    • EUR 606.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody

    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody

    • EUR 425.00
    • EUR 133.00
    • EUR 1177.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Antibody

    • EUR 829.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Elastin (ELN) Antibody

    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody

    • EUR 871.00
    • EUR 453.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Elastin (ELN) Antibody

    • EUR 1177.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Elastin (ELN) Antibody

    • EUR 1247.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Elastin (ELN) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Anti-ELN antibody

    STJ23529 100 µl
    EUR 277
    Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

    Anti-ELN antibody

    STJ114307 100 µl
    EUR 277
    Description: This gene encodes a protein that is one of the two components of elastic fibers. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa. Multiple transcript variants encoding different isoforms have been found for this gene.

    Anti-ELN antibody

    STJ192995 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ELN

    ELN/ Rat ELN ELISA Kit

    ELA-E1337r 96 Tests
    EUR 886

    Eln/ Rat Eln ELISA Kit

    ELI-04404r 96 Tests
    EUR 886

    Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7

    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Gly392~Ala645)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

    Elastin (ELN) Polyclonal Antibody (Human), APC-Cy7

    • EUR 590.00
    • EUR 6718.00
    • EUR 1777.00
    • EUR 788.00
    • EUR 328.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CPB337Hu21-OVA Conjugated Elastin (ELN)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

    Elastin (ELN) Polyclonal Antibody (Mouse), APC-Cy7

    • EUR 560.00
    • EUR 6286.00
    • EUR 1669.00
    • EUR 745.00
    • EUR 315.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ELN (Pro266~Gly443)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Elastin (ELN). This antibody is labeled with APC-Cy7.

    ELISA kit for Rabbit ELN (Elastin)

    E-EL-RB0506 1 plate of 96 wells
    EUR 584
    • Gentaur's ELN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rabbit ELN. Standards or samples are added to the micro ELISA plate wells and combined with the
    • Show more
    Description: A sandwich ELISA kit for quantitative measurement of Rabbit ELN (Elastin) in samples from Serum, Plasma, Cell supernatant

    ELN siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.


    HY-15043 10mg
    EUR 739

    ELN siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ELN siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Elastin (ELN) Antibody (FITC)

    • EUR 467.00
    • EUR 244.00
    • EUR 1358.00
    • EUR 648.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Elastin (ELN) Antibody Pair

    • EUR 1664.00
    • EUR 1066.00
    • 10 × 96 tests
    • 5 × 96 tests
    • Shipped within 5-15 working days.

    Elastin (ELN) Antibody (FITC)

    • EUR 467.00
    • EUR 244.00
    • EUR 1386.00
    • EUR 648.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Elastin (ELN) Antibody (Biotin)

    • EUR 453.00
    • EUR 244.00
    • EUR 1288.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Elastin (ELN) Antibody (Biotin)

    • EUR 439.00
    • EUR 244.00
    • EUR 1261.00
    • EUR 606.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Elastin (ELN) Monoclonal Antibody (Human)

    • EUR 247.00
    • EUR 2523.00
    • EUR 628.00
    • EUR 311.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN)

    ELN cloning plasmid

    CSB-CL007617HU-10ug 10ug
    EUR 663
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1977
    • Sequence: atggcgggtctgacggcggcggccccgcggcccggagtcctcctgctcctgctgtccatcctccacccctctcggcctggaggggtccctggggccattcctggtggagttcctggaggagtcttttatccaggggctggtctcggagcccttggaggaggagcgctggggcctg
    • Show more
    Description: A cloning plasmid for the ELN gene.

    ELN 318463 racemate

    HY-50882A 5mg
    EUR 601

    ELN Blocking Peptide

    DF7064-BP 1mg
    EUR 195

    Recombinant Elastin (ELN)

    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P15502
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 22.9kDa
    • Isoelectric Point: 10.3
    Description: Recombinant Human Elastin expressed in: E.coli

    Recombinant Elastin (ELN)

    • EUR 499.62
    • EUR 236.00
    • EUR 1598.56
    • EUR 599.52
    • EUR 1099.04
    • EUR 397.00
    • EUR 3846.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P54320
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 47.3kDa
    • Isoelectric Point: 9
    Description: Recombinant Mouse Elastin expressed in: E.coli

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC551981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF555 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC551981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF555 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC611981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF660R conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC611981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF660R conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC401981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF640R conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC401981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF640R conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC471981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF647 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC471981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF647 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC051981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405M conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC051981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405M conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC041981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405S conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC041981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF405S conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC431981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF543 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC431981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF543 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNUB1981-100 100uL
    EUR 264
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNUB1981-50 50uL
    EUR 405
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), 1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNUB1981-500 500uL
    EUR 513
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Concentration: 0.2mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC681981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF568 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC681981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF568 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC701981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF770 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC701981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF770 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC881981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF488A conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC881981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF488A conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC941981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF594 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC941981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF594 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCB1981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Biotin conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCB1981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Biotin conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCH1981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCH1981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC801981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC801981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680 conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCP1981-250 250uL
    EUR 394
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), PerCP conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCR1981-250 250uL
    EUR 394
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), RPE conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCA1981-250 250uL
    EUR 394
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), APC conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCAP1981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNCAP1981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC811981-100 100uL
    EUR 233
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680R conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981) Antibody

    BNC811981-500 500uL
    EUR 545
    Description: Primary antibody against Elastin (ELN) (Marker of Arterial Stiffness and Atherosclerosis) (ELN/1981), CF680R conjugate, Concentration: 0.1mg/mL

    Elastin (ELN) MonoSpecific Antibody, Unconjugated-20ug

    2006-MSM1-P0 20ug
    EUR 233

    Elastin (ELN) MonoSpecific Antibody, Unconjugated-100ug

    2006-MSM1-P1 100ug
    EUR 428

    Elastin (ELN) Monoclonal Antibody (Human), APC

    • EUR 346.00
    • EUR 3293.00
    • EUR 917.00
    • EUR 441.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with APC.

    Elastin (ELN) Monoclonal Antibody (Human), Biotinylated

    • EUR 312.00
    • EUR 2473.00
    • EUR 730.00
    • EUR 382.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with Biotin.

    Elastin (ELN) Monoclonal Antibody (Human), Cy3

    • EUR 420.00
    • EUR 4349.00
    • EUR 1181.00
    • EUR 547.00
    • EUR 252.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with Cy3.

    Elastin (ELN) Monoclonal Antibody (Human), FITC

    • EUR 297.00
    • EUR 2654.00
    • EUR 753.00
    • EUR 373.00
    • EUR 196.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with FITC.

    Elastin (ELN) Monoclonal Antibody (Human), HRP

    • EUR 316.00
    • EUR 2870.00
    • EUR 811.00
    • EUR 399.00
    • EUR 207.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with HRP.

    Elastin (ELN) Monoclonal Antibody (Human), PE

    • EUR 297.00
    • EUR 2654.00
    • EUR 753.00
    • EUR 373.00
    • EUR 196.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with PE.

    Rat Elastin (ELN) Protein

    • EUR 746.00
    • EUR 300.00
    • EUR 2332.00
    • EUR 885.00
    • EUR 523.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Rat ELN shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human ELN ELISA Kit

    EHE0057 96Tests
    EUR 521

    Human ELN ELISA Kit

    ELA-E1337h 96 Tests
    EUR 824

    Goat ELN ELISA Kit

    EGTE0057 96Tests
    EUR 521

    Canine ELN ELISA Kit

    ECE0057 96Tests
    EUR 521

    Chicken ELN ELISA Kit

    ECKE0057 96Tests
    EUR 521

    Bovine ELN ELISA Kit

    EBE0057 96Tests
    EUR 521

    Anserini ELN ELISA Kit

    EAE0057 96Tests
    EUR 521


    EF005387 96 Tests
    EUR 689

    Porcine ELN ELISA Kit

    EPE0057 96Tests
    EUR 521

    Rat ELN ELISA Kit

    ERE0057 96Tests
    EUR 521

    Sheep ELN ELISA Kit

    ESE0057 96Tests
    EUR 521

    Mouse ELN ELISA Kit

    EME0057 96Tests
    EUR 521

    Monkey ELN ELISA Kit

    EMKE0057 96Tests
    EUR 521

    Human Elastin (ELN) Protein

    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Mouse Elastin (ELN) Protein

    • EUR 704.00
    • EUR 286.00
    • EUR 2151.00
    • EUR 829.00
    • EUR 495.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Human ELN shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse ELN shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    OVA Conjugated Elastin (ELN)

    • EUR 226.34
    • EUR 163.00
    • EUR 573.76
    • EUR 257.92
    • EUR 415.84
    • EUR 214.00
    • EUR 1284.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P15502
    • Buffer composition: PBS, pH 7.4.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): Inquire
    • Isoelectric Point: Inquire
    Description: Recombinant Human Elastin expressed in: chemical synthesis

    KLH conjugated Elastin (ELN)

    • EUR 413.60
    • EUR 214.00
    • EUR 1276.00
    • EUR 492.00
    • EUR 884.00
    • EUR 340.00
    • EUR 3040.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P15502
    • Buffer composition: PBS, pH 7.4.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): Inquire
    • Isoelectric Point: Inquire
    Description: Recombinant Human Elastin expressed in: chemical synthesis

    Elastin (ELN) Monoclonal Antibody (Human), APC-Cy7

    • EUR 572.00
    • EUR 6466.00
    • EUR 1714.00
    • EUR 763.00
    • EUR 320.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: Gly392~Ala645
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Mouse monoclonal antibody against Human Elastin (ELN). This antibody is labeled with APC-Cy7.

    Cow Elastin (ELN) ELISA Kit

    abx516439-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Chicken Elastin (ELN) ELISA Kit

    abx516440-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Elastin (ELN) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Human Elastin (ELN) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Elastin (ELN) ELISA Kit

    abx570725-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Elastin (ELN) ELISA Kit

    abx573212-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Rat Elastin (ELN) ELISA Kit

    abx575582-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Rat Eln/ Elastin ELISA Kit

    E0324Ra 1 Kit
    EUR 571

    Guinea Pig ELN ELISA Kit

    EGE0057 96Tests
    EUR 521

    Human ELN/ Elastin ELISA Kit

    E0779Hu 1 Kit
    EUR 571

    Human ELN(Elastin) ELISA Kit

    EH1505 96T
    EUR 524.1
    • Detection range: 0.469-30 ng/ml
    • Uniprot ID: P15502
    • Alias: ELN(Elastin)
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.281 ng/ml

    Human Elastin, ELN ELISA KIT

    ELI-04402h 96 Tests
    EUR 824

    Bovine Elastin, ELN ELISA KIT

    ELI-04403b 96 Tests
    EUR 928

    Chicken Elastin, ELN ELISA KIT

    ELI-04405c 96 Tests
    EUR 928

    Mouse Elastin, Eln ELISA KIT

    ELI-04406m 96 Tests
    EUR 865

    Mouse Elastin(ELN)ELISA Kit

    GA-E0981MS-48T 48T
    EUR 336

    Mouse Elastin(ELN)ELISA Kit

    GA-E0981MS-96T 96T
    EUR 534

    Human Elastin(ELN)ELISA Kit

    GA-E1491HM-48T 48T
    EUR 289

    Human Elastin(ELN)ELISA Kit

    GA-E1491HM-96T 96T
    EUR 466

    Rat Eln(Elastin) ELISA Kit

    ER0508 96T
    EUR 524.1
    • Detection range: 0.625-40 ng/ml
    • Uniprot ID: Q99372
    • Alias: Eln
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.375 ng/ml

    Mouse ELN(Elastin) ELISA Kit

    EM1002 96T
    EUR 524.1
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P54320
    • Alias: ELN
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml

    Rat Elastin (ELN) ELISA Kit

    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Mouse Elastin (ELN) ELISA Kit

    • EUR 7237.00
    • EUR 3855.00
    • EUR 895.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Elastin (ELN) ELISA Kit

    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Elastin (ELN) ELISA Kit

    abx051363-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Pig Elastin (ELN) ELISA Kit

    abx353422-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Dog Elastin (ELN) ELISA Kit

    abx354620-96tests 96 tests
    EUR 926
    • Shipped within 5-12 working days.

    Chicken Elastin (ELN) ELISA Kit

    abx354750-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Monkey Elastin (ELN) ELISA Kit

    abx354963-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Sheep Elastin (ELN) ELISA Kit

    abx355373-96tests 96 tests
    EUR 926
    • Shipped within 5-12 working days.

    Human Elastin (ELN) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Mouse Elastin (ELN) CLIA Kit

    • EUR 8569.00
    • EUR 4560.00
    • EUR 1052.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Rat Elastin (ELN) CLIA Kit

    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.

    Rat Elastin (ELN) ELISA Kit

    abx256485-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Human Elastin (ELN) ELISA Kit

    abx250788-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Mouse Elastin (ELN) ELISA Kit

    abx254055-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.

    Human Elastin (ELN) CLIA Kit

    abx196626-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Mouse Elastin (ELN) CLIA Kit

    abx196926-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Rat Elastin (ELN) CLIA Kit

    abx196927-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human Elastin,ELN ELISA Kit

    201-12-1475 96 tests
    EUR 440
    • This Elastin ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
    Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

    Pig Elastin (ELN) ELISA Kit

    CSB-E15814p-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Pig Elastin (ELN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Pig Elastin (ELN) ELISA Kit

    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Pig Elastin (ELN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Mouse Elastin(ELN) ELISA kit

    CSB-EL007617MO-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Mouse Elastin (ELN) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Mouse Elastin(ELN) ELISA kit

    • EUR 804.00
    • EUR 5099.00
    • EUR 2704.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Mouse Elastin(ELN) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Human Elastin, ELN ELISA Kit

    CSB-E09338h-24T 1 plate of 24 wells
    EUR 165
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Elastin, ELN in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates, urine. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

    Human Elastin, ELN ELISA Kit

    • EUR 900.00
    • EUR 5476.00
    • EUR 2900.00
    • 1 plate of 96 wells
    • 10 plates of 96 wells each
    • 5 plates of 96 wells each
    • Sample volume: 50-100ul
    • Detection wavelength: 450nm
    • Assay performance time: 1 to 4 hours.
    Description: Quantitativesandwich ELISA kit for measuring Human Elastin, ELN in samples from serum, plasma, cell culture supernates, tissue homogenates, cell lysates, urine. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

    Chicken ELN/ Elastin ELISA Kit

    E0022Ch 1 Kit
    EUR 717

    ELN ORF Vector (Human) (pORF)

    ORF003534 1.0 ug DNA
    EUR 95

    Eln ORF Vector (Rat) (pORF)

    ORF066505 1.0 ug DNA
    EUR 506

    Eln ORF Vector (Mouse) (pORF)

    ORF043851 1.0 ug DNA
    EUR 506

    Human Elastin (ELN) ELISA Kit

    SEB337Hu-10x96wellstestplate 10x96-wells test plate
    EUR 4502.43
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Elastin (ELN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Elastin (ELN) ELISA Kit

    SEB337Hu-1x48wellstestplate 1x48-wells test plate
    EUR 458.44
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Elastin (ELN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Elastin (ELN) ELISA Kit

    SEB337Hu-1x96wellstestplate 1x96-wells test plate
    EUR 612.05
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Elastin (ELN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Elastin (ELN) ELISA Kit

    SEB337Hu-5x96wellstestplate 5x96-wells test plate
    EUR 2454.23
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Elastin (ELN) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

    Human Elastin (ELN) ELISA Kit

    • EUR 4553.00
    • EUR 2405.00
    • EUR 613.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Elastin elisa. Alternative names of the recognized antigen: WBS, WS, SVAS
    • Tropoelastin
    • Supravalvular Aortic Stenosis
    • Williams-Beuren Syndrome
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Elastin (ELN) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

    Mouse Elastin (ELN) ELISA Kit

    SEB337Mu-10x96wellstestplate 10x96-wells test plate
    EUR 4626.78
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Elastin (ELN) in serum, plasma and other biological fluids.

    Mouse Elastin (ELN) ELISA Kit

    SEB337Mu-1x48wellstestplate 1x48-wells test plate
    EUR 468.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Elastin (ELN) in serum, plasma and other biological fluids.

    Mouse Elastin (ELN) ELISA Kit

    SEB337Mu-1x96wellstestplate 1x96-wells test plate
    EUR 626.68
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Elastin (ELN) in serum, plasma and other biological fluids.

    Mouse Elastin (ELN) ELISA Kit

    SEB337Mu-5x96wellstestplate 5x96-wells test plate
    EUR 2520.06
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Elastin (ELN) in serum, plasma and other biological fluids.

    Mouse Elastin (ELN) ELISA Kit

    • EUR 4677.00
    • EUR 2471.00
    • EUR 627.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Elastin elisa. Alternative names of the recognized antigen: WBS, WS, SVAS
    • Tropoelastin
    • Supravalvular Aortic Stenosis
    • Williams-Beuren Syndrome
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Elastin (ELN) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

    Rat Elastin (ELN) ELISA Kit

    SEB337Ra-10x96wellstestplate 10x96-wells test plate
    EUR 4875.49
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Elastin (ELN) in serum, plasma and other biological fluids.

    Rat Elastin (ELN) ELISA Kit

    SEB337Ra-1x48wellstestplate 1x48-wells test plate
    EUR 489.16
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Elastin (ELN) in serum, plasma and other biological fluids.

    Rat Elastin (ELN) ELISA Kit

    SEB337Ra-1x96wellstestplate 1x96-wells test plate
    EUR 655.94
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Elastin (ELN) in serum, plasma and other biological fluids.

    Rat Elastin (ELN) ELISA Kit

    SEB337Ra-5x96wellstestplate 5x96-wells test plate
    EUR 2651.73
    • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Elastin (ELN) were tested on 3 different plates, 8 replicates in each plate
    • CV(%) = SD/meanX100
    • Intra-Assay: CV<10%
    • Inter-Assay: CV<12%
    Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Elastin (ELN) in serum, plasma and other biological fluids.

    Rat Elastin (ELN) ELISA Kit

    • EUR 4926.00
    • EUR 2602.00
    • EUR 656.00
    • 10 plates of 96 wells
    • 5 plates of 96 wells
    • 1 plate of 96 wells
    • Known also as Elastin elisa. Alternative names of the recognized antigen: WBS, WS, SVAS
    • Tropoelastin
    • Supravalvular Aortic Stenosis
    • Williams-Beuren Syndrome
    Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Elastin (ELN) in samples from serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species.

    Human Elastin ELISA Kit (ELN)

    RK01307 96 Tests
    EUR 521

    Human Elastin(ELN)ELISA Kit

    QY-E03904 96T
    EUR 394

    Human Elastin (ELN)ELISA Kit

    QY-E05297 96T
    EUR 394

    Rat Elastin(ELN)ELISA Kit

    QY-E10331 96T
    EUR 361

    Mouse Elastin(ELN)ELISA Kit

    QY-E20511 96T
    EUR 361

    pECMV-Eln-m-FLAG Plasmid

    PVT15283 2 ug
    EUR 325

    ELN ELISA Kit (Human) (OKAN05368)

    OKAN05368 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a protein that is one of the two components of elastic fibers. Elastic fibers comprise part of the extracellular matrix and confer elasticity to organs and tissues including the heart, skin, lungs, ligaments, and blood vessels. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Degradation products of the encoded protein, known as elastin-derived peptides or elastokines, bind the elastin receptor complex and other receptors and stimulate migration and proliferation of monocytes and skin fibroblasts. Elastokines can also contribute to cancer progression. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.14 ng/mL

    ELN ELISA Kit (Human) (OKAN05369)

    OKAN05369 96 Wells
    EUR 792
    Description: Description of target: This gene encodes a protein that is one of the two components of elastic fibers. Elastic fibers comprise part of the extracellular matrix and confer elasticity to organs and tissues including the heart, skin, lungs, ligaments, and blood vessels. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Degradation products of the encoded protein, known as elastin-derived peptides or elastokines, bind the elastin receptor complex and other receptors and stimulate migration and proliferation of monocytes and skin fibroblasts. Elastokines can also contribute to cancer progression. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.18 ng/mL

    ELN ELISA Kit (Human) (OKCD05273)

    OKCD05273 96 Wells
    EUR 870
    Description: Description of target: This gene encodes a protein that is one of the two components of elastic fibers. Elastic fibers comprise part of the extracellular matrix and confer elasticity to organs and tissues including the heart, skin, lungs, ligaments, and blood vessels. The encoded protein is rich in hydrophobic amino acids such as glycine and proline, which form mobile hydrophobic regions bounded by crosslinks between lysine residues. Degradation products of the encoded protein, known as elastin-derived peptides or elastokines, bind the elastin receptor complex and other receptors and stimulate migration and proliferation of monocytes and skin fibroblasts. Elastokines can also contribute to cancer progression. Deletions and mutations in this gene are associated with supravalvular aortic stenosis (SVAS) and autosomal dominant cutis laxa.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.14ng/mL

    ELN Rabbit Polyclonal Antibody