P2RY2 Rabbit Polyclonal Antibody

P2RY2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    P2RY2 Rabbit pAb

    A13923-100ul 100 ul
    EUR 308

    P2RY2 Rabbit pAb

    A13923-200ul 200 ul
    EUR 459

    P2RY2 Rabbit pAb

    A13923-20ul 20 ul
    EUR 183

    P2RY2 Rabbit pAb

    A13923-50ul 50 ul
    EUR 223

    P2RY2 Rabbit pAb

    A5779-100ul 100 ul
    EUR 308

    P2RY2 Rabbit pAb

    A5779-200ul 200 ul
    EUR 459

    P2RY2 Rabbit pAb

    A5779-20ul 20 ul
    EUR 183

    P2RY2 Rabbit pAb

    A5779-50ul 50 ul
    EUR 223

    P2RY2 Antibody

    33041-100ul 100ul
    EUR 252

    P2RY2 Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against P2RY2. Recognizes P2RY2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:10000, WB:1:1000-1:5000

    P2RY2 Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against P2RY2. Recognizes P2RY2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:25-1:100

    P2RY2 Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against P2RY2. Recognizes P2RY2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000

    P2RY2 Antibody

    DF10259 200ul
    EUR 304
    Description: P2RY2 Antibody detects endogenous levels of total P2RY2.

    P2RY2 Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against P2RY2. Recognizes P2RY2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:25-1:100

    P2RY2 Antibody

    ABD10259 100 ug
    EUR 438

    Polyclonal P2RY2 antibody - C-terminal region

    APR12687G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RY2 - C-terminal region. This antibody is tested and proven to work in the following applications:

    P2RY2 Conjugated Antibody

    C33041 100ul
    EUR 397

    Anti-P2RY2 antibody

    STJ28346 100 µl
    EUR 277
    Description: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene.

    Anti-P2RY2 antibody

    STJ115858 100 µl
    EUR 277
    Description: The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, found on many cell types, is activated by ATP and UTP and is reported to be overexpressed on some cancer cell types. It is involved in many cellular functions, such as proliferation, apoptosis and inflammation. Three transcript variants encoding the same protein have been identified for this gene.

    Anti-P2RY2 antibody

    STJ13100215 100 µl
    EUR 427

    Anti-P2RY2 antibody

    STJ13100227 100 µl
    EUR 427

    Anti-P2RY2 antibody

    STJ13100228 100 µl
    EUR 427

    Anti-P2RY2 antibody

    STJ192778 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to P2RY2

    P2ry2/ Rat P2ry2 ELISA Kit

    ELI-21179r 96 Tests
    EUR 886

    P2RY2 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    P2RY2 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    P2RY2 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Rabbit P2Y purinoceptor 2(P2RY2) ELISA kit

    E04P0819-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit P2Y purinoceptor 2(P2RY2) ELISA kit

    E04P0819-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit P2Y purinoceptor 2(P2RY2) ELISA kit

    E04P0819-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    P2RY2 Blocking Peptide

    DF10259-BP 1mg
    EUR 195

    P2RY2 cloning plasmid

    CSB-CL017334HU1-10ug 10ug
    EUR 427
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1134
    • Sequence: atggcagcagacctgggcccctggaatgacaccatcaatggcacctgggatggggatgagctgggctacaggtgccgcttcaacgaggacttcaagtacgtgctgctgcctgtgtcctacggcgtggtgtgcgtgcttgggctgtgtctgaacgccgtggcgctctacatcttct
    • Show more
    Description: A cloning plasmid for the P2RY2 gene.

    P2RY2 cloning plasmid

    CSB-CL017334HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1134
    • Sequence: atggcagcagacctgggcccctggaatgacaccatcaatggcacctgggatggggatgagctgggctacaggtgccgcttcaacgaggacttcaagtacgtgctgctgcctgtgtcctacggcgtggtgtgcgtgcttgggctgtgtctgaacgccgtggcgctctacatcttct
    • Show more
    Description: A cloning plasmid for the P2RY2 gene.

    P2RY2 ELISA KIT|Human

    EF007399 96 Tests
    EUR 689

    Mouse P2RY2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat P2RY2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human P2RY2 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    P2RY2 Recombinant Protein (Human)

    RP022366 100 ug Ask for price

    P2RY2 Recombinant Protein (Human)

    RP022369 100 ug Ask for price

    P2RY2 Recombinant Protein (Mouse)

    RP159800 100 ug Ask for price

    P2RY2 Recombinant Protein (Rat)

    RP219083 100 ug Ask for price

    P2ry2 ORF Vector (Rat) (pORF)

    ORF073029 1.0 ug DNA
    EUR 506

    P2RY2 ORF Vector (Human) (pORF)

    ORF007456 1.0 ug DNA
    EUR 95

    P2RY2 ORF Vector (Human) (pORF)

    ORF007457 1.0 ug DNA
    EUR 95

    P2ry2 ORF Vector (Mouse) (pORF)

    ORF053268 1.0 ug DNA
    EUR 506

    P2RY2 ELISA Kit (Human) (OKCA01406)

    OKCA01406 96 Wells
    EUR 846
    Description: Description of target: Receptor for ATP and UTP coupled to G-proteins that activate a phosphatidylinositol-calcium second messenger system. The affinity range is UTP = ATP > ATP-gamma-S >> 2-methylthio-ATP = ADP. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 6.25 pg/mL

    P2ry2 sgRNA CRISPR Lentivector set (Rat)

    K6823401 3 x 1.0 ug
    EUR 339

    P2ry2 sgRNA CRISPR Lentivector set (Mouse)

    K3901901 3 x 1.0 ug
    EUR 339

    P2RY2 sgRNA CRISPR Lentivector set (Human)

    K1582101 3 x 1.0 ug
    EUR 339

    Purinergic Receptor P2Y, G Protein Coupled 2 (P2RY2) Antibody

    abx028265-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 2 (P2RY2) Antibody

    abx028265-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 2 (P2RY2) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 2 (P2RY2) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 2 (P2RY2) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 2 (P2RY2) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Purinergic Receptor P2Y, G Protein Coupled 2 (P2RY2) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Rat P2Y purinoceptor 2(P2RY2) ELISA kit

    E02P0819-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat P2Y purinoceptor 2(P2RY2) ELISA kit

    E02P0819-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rat P2Y purinoceptor 2(P2RY2) ELISA kit

    E02P0819-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rat P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse P2Y purinoceptor 2(P2RY2) ELISA kit

    E03P0819-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse P2Y purinoceptor 2(P2RY2) ELISA kit

    E03P0819-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Mouse P2Y purinoceptor 2(P2RY2) ELISA kit

    E03P0819-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Mouse P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human P2Y purinoceptor 2(P2RY2) ELISA kit

    E01P0819-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human P2Y purinoceptor 2(P2RY2) ELISA kit

    E01P0819-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Human P2Y purinoceptor 2(P2RY2) ELISA kit

    E01P0819-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Human P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Goat P2Y purinoceptor 2(P2RY2) ELISA kit

    E06P0819-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Goat P2Y purinoceptor 2(P2RY2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    P2RY2 Rabbit Polyclonal Antibody