STIP1 Rabbit Polyclonal Antibody

STIP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

STIP1 Polyclonal Antibody
A54796	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

STIP1 Polyclonal Antibody
ABP60539-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human STIP1 protein Applications tips:
Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

STIP1 Polyclonal Antibody
ABP60539-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human STIP1 protein Applications tips:
Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

STIP1 Polyclonal Antibody
ABP60539-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human STIP1 protein Applications tips:
Description: A polyclonal antibody for detection of STIP1 from Human. This STIP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human STIP1 protein

StIp1 Polyclonal Antibody
ES3522-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against StIp1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

StIp1 Polyclonal Antibody
ES3522-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against StIp1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

STIP1 Polyclonal Antibody
ES11756-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against STIP1. This antibody is tested and validated for WB, ELISA, WB, ELISA

STIP1 Polyclonal Antibody
ES11756-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against STIP1. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit
DLR-STIP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stress Induced Phosphoprotein 1 (STIP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit
DLR-STIP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Stress Induced Phosphoprotein 1 (STIP1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit
RD-STIP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit
RD-STIP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit
RDR-STIP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Stress Induced Phosphoprotein 1 (STIP1) ELISA Kit
RDR-STIP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

STIP1 Rabbit pAb
A14106-100ul	Abclonal	100 ul	EUR 308

STIP1 Rabbit pAb
A14106-200ul	Abclonal	200 ul	EUR 459

STIP1 Rabbit pAb
A14106-20ul	Abclonal	20 ul	EUR 183

STIP1 Rabbit pAb
A14106-50ul	Abclonal	50 ul	EUR 223

STIP1 Rabbit pAb
A1219-100ul	Abclonal	100 ul	EUR 308

STIP1 Rabbit pAb
A1219-200ul	Abclonal	200 ul	EUR 459

STIP1 Rabbit pAb
A1219-20ul	Abclonal	20 ul	EUR 183

STIP1 Rabbit pAb
A1219-50ul	Abclonal	50 ul	EUR 223

Polyclonal STIP1 Antibody (Center)
APR05081G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STIP1 (Center). This antibody is tested and proven to work in the following applications:

Polyclonal STIP1 Antibody (C-term)
APR05080G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human STIP1 (C-term). This antibody is tested and proven to work in the following applications:

STIP1 Polyclonal Antibody, Biotin Conjugated
A54793	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

STIP1 Polyclonal Antibody, FITC Conjugated
A54794	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

STIP1 Polyclonal Antibody, HRP Conjugated
A54795	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

STIP1 antibody
22582-100ul	SAB	100ul	EUR 390

STIP1 antibody
70R-12703	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal STIP1 antibody

STIP1 antibody
70R-1288	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal STIP1 antibody

STIP1 antibody
70R-1289	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal STIP1 antibody

STIP1 antibody
70R-20588	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal STIP1 antibody

STIP1 Antibody
32236-100ul	SAB	100ul	EUR 252

STIP1 Antibody
49844-100ul	SAB	100ul	EUR 333

STIP1 Antibody
49844-50ul	SAB	50ul	EUR 239

STIP1 Antibody
DF6351	Affbiotech	200ul	EUR 304
Description: STIP1 Antibody detects endogenous levels of total STIP1.

STIP1 Antibody
1-CSB-PA022831GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

STIP1 Antibody
1-CSB-PA022831HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

StIp1 Antibody
AF9204	Affbiotech	200ul	EUR 304
Description: StIp1 Antibody detects endogenous levels of total StIp1.

StIp1 Antibody
ABF9204	Lifescience Market	100 ug	EUR 438

STIP1 Antibody
ABD6351	Lifescience Market	100 ug	EUR 438

Anti-StIp1 Antibody
A07823	BosterBio	100ul	EUR 397
Description: Rabbit Polyclonal Antibody for StIp1 Antibody (ELP2) detection. Tested with WB in Human.

STIP1 Conjugated Antibody
C49844	SAB	100ul	EUR 397

STIP1 Conjugated Antibody
C32236	SAB	100ul	EUR 397

anti- STIP1 antibody
FNab08323	FN Test	100µg	EUR 548.75
Immunogen: stress-induced-phosphoprotein 1 Uniprot ID: P31948 Gene ID: 10963 Research Area: Cardiovascular
Description: Antibody raised against STIP1

Anti-STIP1 antibody
PAab08323	Lifescience Market	100 ug	EUR 386

Anti-STIP1 Antibody
PB9896	BosterBio	100ug/vial	EUR 294

Anti-STIP1 antibody
STJ25731	St John's Laboratory	100 µl	EUR 277

Anti-STIP1 antibody
STJ116041	St John's Laboratory	100 µl	EUR 277

Anti-STIP1 antibody
STJ192914	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to STIP1

Anti-StIp1 antibody
STJ95824	St John's Laboratory	200 µl	EUR 197
Description: Rabbit polyclonal to StIp1.

STIP1 siRNA
20-abx905329	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STIP1 siRNA
20-abx935450	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

STIP1 siRNA
20-abx935451	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-STIP1
YF-PA17333	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to STIP1

anti-STIP1
YF-PA17334	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to STIP1

anti-STIP1
YF-PA21419	Abfrontier	50 ul	EUR 363
Description: Mouse polyclonal to STIP1

anti-STIP1
YF-PA26731	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to STIP1

anti-STIP1
YF-PA25702	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to STIP1

STIP1 Antibody, HRP conjugated
1-CSB-PA022831HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

STIP1 Antibody, FITC conjugated
1-CSB-PA022831HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

STIP1 Antibody, Biotin conjugated
1-CSB-PA022831HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against STIP1. Recognizes STIP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

STIP1 recombinant monoclonal antibody
A5499	Bimake	100ul X 3	EUR 595
Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however, Show more
Description: A recombinant monoclonal antibody from rabbit against human STIP1 for WB, IF,ELISA

Anti-STIP1 Monoclonal Antibody
M02683	BosterBio	100ug	EUR 397
Description: Rabbit Monoclonal STIP1 Antibody. Validated in IP, IF, WB and tested in Human, Mouse, Rat.

STIP1 Blocking Peptide
33R-10212	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of STIP1 antibody, catalog no. 70R-1289

STIP1 Blocking Peptide
33R-1327	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of LIG1 antibody, catalog no. 70R-5621

STIP1 Blocking Peptide
DF6351-BP	Affbiotech	1mg	EUR 195

STIP1 cloning plasmid
CSB-CL022831HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1632 Sequence: atggagcaggtcaatgagctgaaggagaaaggcaacaaggccctgagcgtgggtaacatcgatgatgccttacagtgctactccgaagctattaagctggatccccacaaccacgtgctgtacagcaaccgttctgctgcctatgccaagaaaggagactaccagaaggcttatg Show more
Description: A cloning plasmid for the STIP1 gene.

StIp1 Blocking Peptide
AF9204-BP	Affbiotech	1mg	EUR 195

Anti-STIP1 (4B6)
YF-MA11328	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to STIP1

Anti-STIP1 (1E3)
YF-MA11329	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to STIP1

Anti-STIP1 (3D6)
YF-MA11695	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to STIP1

STIP1 Rabbit Polyclonal Antibody