UCP1 Rabbit Polyclonal Antibody

UCP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    UCP1 Polyclonal Antibody
    ABP60848-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
    UCP1 Polyclonal Antibody
    ABP60848-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
    UCP1 Polyclonal Antibody
    ABP60848-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
    UCP1 Polyclonal Antibody
    A54906 100 µg
    EUR 570.55
    Description: Ask the seller for details
    UCP1 Rabbit pAb
    A7236-100ul 100 ul
    EUR 384
    UCP1 Rabbit pAb
    A7236-200ul 200 ul Ask for price
    UCP1 Rabbit pAb
    A7236-20ul 20 ul
    EUR 183
    UCP1 Rabbit pAb
    A7236-50ul 50 ul
    EUR 265
    UCP1 Rabbit pAb
    A5857-100ul 100 ul
    EUR 308
    UCP1 Rabbit pAb
    A5857-200ul 200 ul
    EUR 459
    UCP1 Rabbit pAb
    A5857-20ul 20 ul
    EUR 183
    UCP1 Rabbit pAb
    A5857-50ul 50 ul
    EUR 223
    Anti-UCP1/UCP1 Antibody
    A00255 100ug/vial
    EUR 294
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Hu-48T 48T
    EUR 517
    • Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Hu-96T 96T
    EUR 673
    • Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Mu-48T 48T
    EUR 527
    • Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Mu-96T 96T
    EUR 688
    • Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Ra-48T 48T
    EUR 549
    • Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Ra-96T 96T
    EUR 718
    • Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Hu-48Tests 48 Tests
    EUR 544
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Hu-96Tests 96 Tests
    EUR 756
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Mu-48Tests 48 Tests
    EUR 557
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Mu-96Tests 96 Tests
    EUR 774
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Ra-48Tests 48 Tests
    EUR 583
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Ra-96Tests 96 Tests
    EUR 811
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Hu-48Tests 48 Tests
    EUR 521
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Hu-96Tests 96 Tests
    EUR 723
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Mu-48Tests 48 Tests
    EUR 533
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Mu-96Tests 96 Tests
    EUR 740
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Ra-48Tests 48 Tests
    EUR 557
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Ra-96Tests 96 Tests
    EUR 775
    Polyclonal Goat Anti-UCP1 Antibody
    AMM05152G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-UCP1 . This antibody is tested and proven to work in the following applications:
    UCP1 Polyclonal Antibody, Biotin Conjugated
    A54903 100 µg
    EUR 570.55
    Description: reagents widely cited
    UCP1 Polyclonal Antibody, FITC Conjugated
    A54904 100 µg
    EUR 570.55
    Description: Ask the seller for details
    UCP1 Polyclonal Antibody, HRP Conjugated
    A54905 100 µg
    EUR 570.55
    Description: The best epigenetics products
    UCP1 antibody
    70R-UR001 100 ug
    EUR 640
    Description: Affinity purified Rabbit polyclonal UCP1 antibody
    UCP1 Antibody
    ABD7720 100 ug
    EUR 438
    UCP1 antibody
    38698-100ul 100ul
    EUR 252
    UCP1 Antibody
    43429-100ul 100ul
    EUR 252
    UCP1 Antibody
    6637-50
    EUR 414
    UCP1 Antibody
    DF7720 200ul
    EUR 304
    Description: UCP1 Antibody detects endogenous levels of total UCP1.
    UCP1 Antibody
    1-CSB-PA216676
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150
    UCP1 Antibody
    1-CSB-PA025554ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    UCP1 Antibody
    1-CSB-PA025554ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
    UCP1 Antibody
    1-CSB-PA025554LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    Polyclonal UCP1 antibody - N-terminal region
    APR10648G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 - N-terminal region. This antibody is tested and proven to work in the following applications:
    UCP1 Conjugated Antibody
    C38698 100ul
    EUR 397
    anti- UCP1 antibody
    FNab09227 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:1000
    • IHC: 1:20-1:200
    • Immunogen: uncoupling protein 1(mitochondrial, proton carrier)
    • Uniprot ID: P25874
    • Gene ID: 7350
    • Research Area: Metabolism
    Description: Antibody raised against UCP1
    Anti-UCP1 antibody
    PAab09227 100 ug
    EUR 386
    Anti-UCP1 Antibody
    PA1981 100ug/vial
    EUR 294
    Anti-UCP1 Antibody
    PA1982 100ug/vial
    EUR 294
    Anti-UCP1 antibody
    STJ70810 100 µg
    EUR 359
    Anti-UCP1 antibody
    STJ28420 100 µl
    EUR 277
    Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.
    Anti-UCP1 antibody
    STJ11100933 100 µl
    EUR 393
    Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.
    Anti-UCP1 antibody
    STJ192982 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to UCP1
    Ucp1/ Rat Ucp1 ELISA Kit
    ELI-06632r 96 Tests
    EUR 886
    Polyclonal UCP1 / UCP-1 Antibody (C-Terminus)
    APR10643G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 / UCP-1 (C-Terminus). This antibody is tested and proven to work in the following applications:
    UCP1 siRNA
    20-abx905932
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    UCP1 siRNA
    20-abx938926
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    UCP1 siRNA
    20-abx938927
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    pGEM-UCP1
    PVT13596 2 ug
    EUR 391
    anti-UCP1
    YF-PA24935 50 ul
    EUR 334
    Description: Mouse polyclonal to UCP1
    UCP1 Antibody, HRP conjugated
    1-CSB-PA025554LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    UCP1 Antibody, FITC conjugated
    1-CSB-PA025554LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    UCP1 Antibody, Biotin conjugated
    1-CSB-PA025554LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse)
    4-PAF557Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1)
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
    4-PAF557Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
    4-PAF557Ra02
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)
    UCP1 cloning plasmid
    CSB-CL025554HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 924
    • Sequence: ATGGGGGGCCTGACAGCCTCGGACGTACACCCGACCCTGGGGGTCCAGCTCTTCTCAGCTGGAATAGCGGCGTGCTTGGCGGACGTGATCACCTTCCCGCTGGACACGGCCAAAGTCCGGCTCCAGGTCCAAGGTGAATGCCCGACGTCCAGTGTTATTAGGTATAAAGGTGTCCT
    • Show more
    Description: A cloning plasmid for the UCP1 gene.
    UCP1 Blocking Peptide
    DF7720-BP 1mg
    EUR 195
    Anti-UCP1 (4E5)
    YF-MA16016 100 ug
    EUR 363
    Description: Mouse monoclonal to UCP1
    Anti-UCP1 (4B7)
    YF-MA16017 50 ug
    EUR 363
    Description: Mouse monoclonal to UCP1
    Anti-UCP1 (4B7)
    YF-MA20450 200 ul
    EUR 363
    Description: Mouse monoclonal to UCP1
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC
    4-PAF557Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Biotinylated
    4-PAF557Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Cy3
    4-PAF557Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), FITC
    4-PAF557Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), HRP
    4-PAF557Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), PE
    4-PAF557Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
    4-PAF557Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
    4-PAF557Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
    4-PAF557Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
    4-PAF557Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
    4-PAF557Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
    4-PAF557Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
    4-PAF557Ra02-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
    4-PAF557Ra02-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
    4-PAF557Ra02-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
    4-PAF557Ra02-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
    4-PAF557Ra02-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
    4-PAF557Ra02-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC-Cy7
    4-PAF557Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
    4-PAF557Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
    4-PAF557Ra02-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx130224
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx103784
    • EUR 314.00
    • EUR 133.00
    • EUR 829.00
    • EUR 439.00
    • EUR 272.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx103785
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx175033
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx178804
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx178805
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx178806
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx210311
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Rat UCP1 shRNA Plasmid
    20-abx984681
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human UCP1 ELISA Kit
    ELA-E2067h 96 Tests
    EUR 824
    Bovine UCP1 ELISA KIT
    ELI-06629b 96 Tests
    EUR 928
    Mouse Ucp1 ELISA KIT
    ELI-06630m 96 Tests
    EUR 865
    Canine UCP1 ELISA KIT
    ELI-06633d 96 Tests
    EUR 928
    Human UCP1 ELISA KIT
    ELI-06634h 96 Tests
    EUR 824
    UCP1 ELISA KIT|Human
    EF006166 96 Tests
    EUR 689
    Human UCP1 shRNA Plasmid
    20-abx955025
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse UCP1 shRNA Plasmid
    20-abx973301
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    UCP1 Recombinant Protein (Human)
    RP044629 100 ug Ask for price
    UCP1 Recombinant Protein (Rat)
    RP235742 100 ug Ask for price
    UCP1 Recombinant Protein (Mouse)
    RP182945 100 ug Ask for price
    pGEM-Ucp1-A8G-m
    PVT14024 2 ug
    EUR 391
    Mouse UCP1 ELISA Kit
    STJ150299 1 kit
    EUR 412
    Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of UCP-1 in Mouse serum, plasma and other biological fluids
    Rabbit Mitochondrial brown fat uncoupling protein 1, UCP1 ELISA
    ELI-06631Ra 96 Tests
    EUR 928
    Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 1
    UCP11-S 100 ul
    EUR 457
    Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 2
    UCP12-S 100 ul
    EUR 457
    Monoclonal UCP1 Antibody (monoclonal) (M01), Clone: 4E6
    APR10646G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4E6. This antibody is applicable in WB, E
    Monoclonal UCP1 Antibody (monoclonal) (M03), Clone: 4B7
    APR10647G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B7. This antibody is applicable in WB, E
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (FITC)
    20-abx273880
    • EUR 495.00
    • EUR 258.00
    • EUR 1455.00
    • EUR 676.00
    • EUR 398.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin)
    20-abx272849
    • EUR 467.00
    • EUR 244.00
    • EUR 1344.00
    • EUR 634.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin)
    20-abx273298
    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.
    m UCP1 inducible lentiviral particles
    LVP905 1x107 IFU/ml x 200ul
    EUR 451
    Description: Pre-made over-expression lentivirus for expressing mouse target: UCP1 (uncoupling protein 1, mitochondrial, proton carrier), [alternative names: AI385626; Slc25a7; Ucp]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_009463. It also contains a RFP-Blasticidin dual selection marker.
    Ucp1 ORF Vector (Rat) (pORF)
    ORF078582 1.0 ug DNA
    EUR 506
    UCP1 ORF Vector (Human) (pORF)
    ORF014877 1.0 ug DNA
    EUR 95
    Ucp1 ORF Vector (Mouse) (pORF)
    ORF060983 1.0 ug DNA
    EUR 506
    UCP1 ELISA Kit (Rat) (OKAN05217)
    OKAN05217 96 Wells
    EUR 792
    Description: Description of target: plays a role in heat production by uncoupling oxidative phosphorylation from the respiratory chain [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL
    UCP1 ELISA Kit (Human) (OKAN05445)
    OKAN05445 96 Wells
    EUR 792
    Description: Description of target: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL
    UCP1 ELISA Kit (Mouse) (OKAN05870)
    OKAN05870 96 Wells
    EUR 792
    Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL
    UCP1 ELISA Kit (Mouse) (OKCD02970)
    OKCD02970 96 Wells
    EUR 857
    Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL
    UCP1 ELISA Kit (Human) (OKCD08810)
    OKCD08810 96 Wells
    EUR 975
    Description: Description of target: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL
    UCP1 ELISA Kit (Rat) (OKCD08811)
    OKCD08811 96 Wells
    EUR 1053
    Description: Description of target: plays a role in heat production by uncoupling oxidative phosphorylation from the respiratory chain.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL
    UCP1 ELISA Kit (Rat) (OKEH03446)
    OKEH03446 96 Wells
    EUR 662
    Description: Description of target: UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091 ng/mL
    UCP1 ELISA Kit (Rat) (OKCA01905)
    OKCA01905 96 Wells
    EUR 846
    Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL
    UCP1 ELISA Kit (Mouse) (OKEH07201)
    OKEH07201 96 Wells
    EUR 662
    Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.5 pg/mL
    UCP1 ELISA Kit (Dog) (OKEH08476)
    OKEH08476 96 Wells
    EUR 1184
    Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34pg/mL
    ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
    KTE90123-48T 48T
    EUR 354
    Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
    KTE90123-5platesof96wells 5 plates of 96 wells
    EUR 2252
    Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
    KTE90123-96T 96T
    EUR 572
    Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) IgG # 1, aff pure
    UCP11-A 100 ul
    EUR 482
    Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) IgG #2, aff pure
    UCP12-A 100 ug
    EUR 482
    Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
    20-abx004494
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
    20-abx005463
    • EUR 495.00
    • EUR 356.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
    20-abx320419
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
    20-abx322345
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
    abx219236-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.
    Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
    abx433424-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
    abx239227-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    UCP1 sgRNA CRISPR Lentivector set (Human)
    K2581701 3 x 1.0 ug
    EUR 339
    Ucp1 sgRNA CRISPR Lentivector set (Mouse)
    K3728401 3 x 1.0 ug
    EUR 339
    Ucp1 sgRNA CRISPR Lentivector set (Rat)
    K7526001 3 x 1.0 ug
    EUR 339
    Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
    4-RPF557Mu01
    • EUR 494.24
    • EUR 235.00
    • EUR 1578.40
    • EUR 592.80
    • EUR 1085.60
    • EUR 394.00
    • EUR 3796.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P12242
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 14.3kDa
    • Isoelectric Point: 7.7
    Description: Recombinant Mouse Uncoupling Protein 1, Mitochondrial expressed in: E.coli
    Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
    4-RPF557Ra01
    • EUR 490.66
    • EUR 234.00
    • EUR 1564.96
    • EUR 588.32
    • EUR 1076.64
    • EUR 391.00
    • EUR 3762.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P04633
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 14.6kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Rat Uncoupling Protein 1, Mitochondrial expressed in: E.coli
    Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
    4-RPF557Ra02
    • EUR 490.66
    • EUR 234.00
    • EUR 1564.96
    • EUR 588.32
    • EUR 1076.64
    • EUR 391.00
    • EUR 3762.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P04633
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 45.0kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Rat Uncoupling Protein 1, Mitochondrial expressed in: E.coli
    Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody (Biotin)
    20-abx105665
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    VEGF Rabbit Polyclonal Antibody
    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    VEGF Rabbit Polyclonal Antibody
    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    CD10 Rabbit Polyclonal Antibody
    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NM23A Rabbit Polyclonal Antibody
    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATM Rabbit Polyclonal Antibody
    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    HSC70 Rabbit Polyclonal Antibody
    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSC70 Rabbit Polyclonal Antibody
    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP40 Rabbit Polyclonal Antibody
    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP40 Rabbit Polyclonal Antibody
    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    HSP90? Rabbit Polyclonal Antibody
    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    HSP90? Rabbit Polyclonal Antibody
    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    IkB ? Rabbit Polyclonal Antibody
    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    IkB ? Rabbit Polyclonal Antibody
    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    JAK1 Rabbit Polyclonal Antibody
    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK1 Rabbit Polyclonal Antibody
    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK2 Rabbit Polyclonal Antibody
    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JAK2 Rabbit Polyclonal Antibody
    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JNK2 Rabbit Polyclonal Antibody
    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    JNK2 Rabbit Polyclonal Antibody
    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC
    JNK3 Rabbit Polyclonal Antibody
    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    JNK3 Rabbit Polyclonal Antibody
    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    MEK2 Rabbit Polyclonal Antibody
    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
    MEK2 Rabbit Polyclonal Antibody
    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC
    MEK3 Rabbit Polyclonal Antibody
    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    MEK3 Rabbit Polyclonal Antibody
    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    Nrf2 Rabbit Polyclonal Antibody
    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    Nrf2 Rabbit Polyclonal Antibody
    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4a Rabbit Polyclonal Antibody
    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4a Rabbit Polyclonal Antibody
    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4b Rabbit Polyclonal Antibody
    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4b Rabbit Polyclonal Antibody
    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4c Rabbit Polyclonal Antibody
    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG4c Rabbit Polyclonal Antibody
    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG5 Rabbit Polyclonal Antibody
    ES8572-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG5 Rabbit Polyclonal Antibody
    ES8572-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG7 Rabbit Polyclonal Antibody
    ES8573-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG7 Rabbit Polyclonal Antibody
    ES8573-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG13 Rabbit Polyclonal Antibody
    ES8574-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG13 Rabbit Polyclonal Antibody
    ES8574-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG13 Rabbit Polyclonal Antibody
    ES8575-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG13 Rabbit Polyclonal Antibody
    ES8575-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG14L Rabbit Polyclonal Antibody
    ES8576-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    ATG14L Rabbit Polyclonal Antibody
    ES8576-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NBR1 Rabbit Polyclonal Antibody
    ES8578-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NBR1 Rabbit Polyclonal Antibody
    ES8578-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NBR1 Rabbit Polyclonal Antibody
    ES8579-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    NBR1 Rabbit Polyclonal Antibody
    ES8579-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC
    WIPI2 Rabbit Polyclonal Antibody
    ES8580-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    UCP1 Rabbit Polyclonal Antibody