UCP1 Rabbit Polyclonal Antibody

UCP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    UCP1 Polyclonal Antibody
    ABP60848-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
    UCP1 Polyclonal Antibody
    ABP60848-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human UCP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein
    UCP1 Polyclonal Antibody
    ES11824-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against UCP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    UCP1 Polyclonal Antibody
    ES11824-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against UCP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    UCP1 Rabbit pAb
    A5857-100ul 100 ul
    EUR 308
    UCP1 Rabbit pAb
    A5857-200ul 200 ul
    EUR 459
    UCP1 Rabbit pAb
    A5857-20ul 20 ul
    EUR 183
    UCP1 Rabbit pAb
    A5857-50ul 50 ul
    EUR 223
    UCP1 Rabbit pAb
    A7236-100ul 100 ul
    EUR 384
    UCP1 Rabbit pAb
    A7236-200ul 200 ul Ask for price
    UCP1 Rabbit pAb
    A7236-20ul 20 ul
    EUR 183
    UCP1 Rabbit pAb
    A7236-50ul 50 ul
    EUR 265
    Anti-UCP1/UCP1 Antibody
    A00255 100ug/vial
    EUR 294
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Hu-48T 48T
    EUR 517
    • Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Hu-96T 96T
    EUR 673
    • Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Mu-48T 48T
    EUR 527
    • Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Mu-96T 96T
    EUR 688
    • Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Ra-48T 48T
    EUR 549
    • Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    DLR-UCP1-Ra-96T 96T
    EUR 718
    • Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Hu-48Tests 48 Tests
    EUR 544
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Hu-96Tests 96 Tests
    EUR 756
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Mu-48Tests 48 Tests
    EUR 557
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Mu-96Tests 96 Tests
    EUR 774
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Ra-48Tests 48 Tests
    EUR 583
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RDR-UCP1-Ra-96Tests 96 Tests
    EUR 811
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Hu-48Tests 48 Tests
    EUR 521
    Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Hu-96Tests 96 Tests
    EUR 723
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Mu-48Tests 48 Tests
    EUR 533
    Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Mu-96Tests 96 Tests
    EUR 740
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Ra-48Tests 48 Tests
    EUR 557
    Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
    RD-UCP1-Ra-96Tests 96 Tests
    EUR 775
    Polyclonal Goat Anti-UCP1 Antibody
    AMM05152G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-UCP1 . This antibody is tested and proven to work in the following applications:
    UCP1 Polyclonal Antibody, Biotin Conjugated
    A54903 100 µg
    EUR 570.55
    Description: reagents widely cited
    UCP1 Polyclonal Antibody, FITC Conjugated
    A54904 100 µg
    EUR 570.55
    Description: Ask the seller for details
    UCP1 Polyclonal Antibody, HRP Conjugated
    A54905 100 µg
    EUR 570.55
    Description: The best epigenetics products
    UCP1 Antibody
    6637-50
    EUR 414
    UCP1 antibody
    38698-100ul 100ul
    EUR 252
    UCP1 Antibody
    43429-100ul 100ul
    EUR 252
    UCP1 Antibody
    DF7720 200ul
    EUR 304
    Description: UCP1 Antibody detects endogenous levels of total UCP1.
    UCP1 Antibody
    1-CSB-PA216676
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150
    UCP1 antibody
    70R-UR001 100 ug
    EUR 640
    Description: Affinity purified Rabbit polyclonal UCP1 antibody
    UCP1 Antibody
    1-CSB-PA025554ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    UCP1 Antibody
    1-CSB-PA025554ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200
    UCP1 Antibody
    1-CSB-PA025554LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    UCP1 Antibody
    ABD7720 100 ug
    EUR 438
    Polyclonal UCP1 antibody - N-terminal region
    APR10648G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 - N-terminal region. This antibody is tested and proven to work in the following applications:
    UCP1 Conjugated Antibody
    C38698 100ul
    EUR 397
    anti- UCP1 antibody
    FNab09227 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:1000
    • IHC: 1:20-1:200
    • Immunogen: uncoupling protein 1(mitochondrial, proton carrier)
    • Uniprot ID: P25874
    • Gene ID: 7350
    • Research Area: Metabolism
    Description: Antibody raised against UCP1
    Anti-UCP1 Antibody
    PA1981 100ug/vial
    EUR 294
    Anti-UCP1 Antibody
    PA1982 100ug/vial
    EUR 294
    Anti-UCP1 antibody
    PAab09227 100 ug
    EUR 386
    Anti-UCP1 antibody
    STJ11100933 100 µl
    EUR 393
    Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.
    Anti-UCP1 antibody
    STJ28420 100 µl
    EUR 277
    Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.
    Anti-UCP1 antibody
    STJ192982 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to UCP1
    Anti-UCP1 antibody
    STJ70810 100 µg
    EUR 359
    Ucp1/ Rat Ucp1 ELISA Kit
    ELI-06632r 96 Tests
    EUR 886
    Polyclonal UCP1 / UCP-1 Antibody (C-Terminus)
    APR10643G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 / UCP-1 (C-Terminus). This antibody is tested and proven to work in the following applications:
    UCP1 siRNA
    20-abx905932
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    UCP1 siRNA
    20-abx938926
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    UCP1 siRNA
    20-abx938927
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    pGEM-UCP1
    PVT13596 2 ug
    EUR 391
    anti-UCP1
    YF-PA24935 50 ul
    EUR 334
    Description: Mouse polyclonal to UCP1
    UCP1 Antibody, HRP conjugated
    1-CSB-PA025554LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    UCP1 Antibody, FITC conjugated
    1-CSB-PA025554LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    UCP1 Antibody, Biotin conjugated
    1-CSB-PA025554LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse)
    4-PAF557Mu01
    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1)
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
    4-PAF557Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
    4-PAF557Ra02
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)
    UCP1 Blocking Peptide
    DF7720-BP 1mg
    EUR 195
    UCP1 cloning plasmid
    CSB-CL025554HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 924
    • Sequence: ATGGGGGGCCTGACAGCCTCGGACGTACACCCGACCCTGGGGGTCCAGCTCTTCTCAGCTGGAATAGCGGCGTGCTTGGCGGACGTGATCACCTTCCCGCTGGACACGGCCAAAGTCCGGCTCCAGGTCCAAGGTGAATGCCCGACGTCCAGTGTTATTAGGTATAAAGGTGTCCT
    • Show more
    Description: A cloning plasmid for the UCP1 gene.
    Anti-UCP1 (4E5)
    YF-MA16016 100 ug
    EUR 363
    Description: Mouse monoclonal to UCP1
    Anti-UCP1 (4B7)
    YF-MA16017 50 ug
    EUR 363
    Description: Mouse monoclonal to UCP1
    Anti-UCP1 (4B7)
    YF-MA20450 200 ul
    EUR 363
    Description: Mouse monoclonal to UCP1
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC
    4-PAF557Mu01-APC
    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Biotinylated
    4-PAF557Mu01-Biotin
    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Cy3
    4-PAF557Mu01-Cy3
    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), FITC
    4-PAF557Mu01-FITC
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), HRP
    4-PAF557Mu01-HRP
    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), PE
    4-PAF557Mu01-PE
    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
    4-PAF557Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
    4-PAF557Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
    4-PAF557Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
    4-PAF557Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
    4-PAF557Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
    4-PAF557Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
    4-PAF557Ra02-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
    4-PAF557Ra02-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
    4-PAF557Ra02-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
    4-PAF557Ra02-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
    4-PAF557Ra02-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
    4-PAF557Ra02-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC-Cy7
    4-PAF557Mu01-APC-Cy7
    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
    4-PAF557Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
    Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
    4-PAF557Ra02-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: UCP1 (Pro179~Leu296)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx178804
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
    20-abx178805
    • EUR 1233.00
    • EUR 592.00
    • 1 mg
    • 200 ug
    • Please enquire.

    UCP1 Rabbit Polyclonal Antibody