UCP1 Rabbit Polyclonal Antibody

UCP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

UCP1 Polyclonal Antibody
ABP60848-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human UCP1 protein Applications tips:
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein

UCP1 Polyclonal Antibody
ABP60848-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human UCP1 protein Applications tips:
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein

UCP1 Polyclonal Antibody
ABP60848-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human UCP1 protein Applications tips:
Description: A polyclonal antibody for detection of UCP1 from Human, Mouse, Rat. This UCP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human UCP1 protein

UCP1 Polyclonal Antibody
A54906	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

UCP1 Rabbit pAb
A7236-100ul	Abclonal	100 ul	EUR 384

UCP1 Rabbit pAb
A7236-200ul	Abclonal	200 ul	Ask for price

UCP1 Rabbit pAb
A7236-20ul	Abclonal	20 ul	EUR 183

UCP1 Rabbit pAb
A7236-50ul	Abclonal	50 ul	EUR 265

UCP1 Rabbit pAb
A5857-100ul	Abclonal	100 ul	EUR 308

UCP1 Rabbit pAb
A5857-200ul	Abclonal	200 ul	EUR 459

UCP1 Rabbit pAb
A5857-20ul	Abclonal	20 ul	EUR 183

UCP1 Rabbit pAb
A5857-50ul	Abclonal	50 ul	EUR 223

Anti-UCP1/UCP1 Antibody
A00255	BosterBio	100ug/vial	EUR 294

Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
DLR-UCP1-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Uncoupling Protein 1, Mitochondrial (UCP1) in samples from tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RDR-UCP1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Uncoupling Protein 1, Mitochondrial (UCP1) ELISA Kit
RD-UCP1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Polyclonal Goat Anti-UCP1 Antibody
AMM05152G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-UCP1 . This antibody is tested and proven to work in the following applications:

UCP1 Polyclonal Antibody, Biotin Conjugated
A54903	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

UCP1 Polyclonal Antibody, FITC Conjugated
A54904	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

UCP1 Polyclonal Antibody, HRP Conjugated
A54905	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

UCP1 antibody
70R-UR001	Fitzgerald	100 ug	EUR 640
Description: Affinity purified Rabbit polyclonal UCP1 antibody

UCP1 Antibody
ABD7720	Lifescience Market	100 ug	EUR 438

UCP1 antibody
38698-100ul	SAB	100ul	EUR 252

UCP1 Antibody
43429-100ul	SAB	100ul	EUR 252

UCP1 Antibody
6637-50	Biovision		EUR 414

UCP1 Antibody
DF7720	Affbiotech	200ul	EUR 304
Description: UCP1 Antibody detects endogenous levels of total UCP1.

UCP1 Antibody
1-CSB-PA216676	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:30-1:150

UCP1 Antibody
1-CSB-PA025554ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

UCP1 Antibody
1-CSB-PA025554ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200

UCP1 Antibody
1-CSB-PA025554LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Polyclonal UCP1 antibody - N-terminal region
APR10648G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 - N-terminal region. This antibody is tested and proven to work in the following applications:

UCP1 Conjugated Antibody
C38698	SAB	100ul	EUR 397

anti- UCP1 antibody
FNab09227	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:1000 IHC: 1：20-1:200 Immunogen: uncoupling protein 1(mitochondrial, proton carrier) Uniprot ID: P25874 Gene ID: 7350 Research Area: Metabolism
Description: Antibody raised against UCP1

Anti-UCP1 antibody
PAab09227	Lifescience Market	100 ug	EUR 386

Anti-UCP1 Antibody
PA1981	BosterBio	100ug/vial	EUR 294

Anti-UCP1 Antibody
PA1982	BosterBio	100ug/vial	EUR 294

Anti-UCP1 antibody
STJ70810	St John's Laboratory	100 µg	EUR 359

Anti-UCP1 antibody
STJ28420	St John's Laboratory	100 µl	EUR 277
Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.

Anti-UCP1 antibody
STJ11100933	St John's Laboratory	100 µl	EUR 393
Description: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.

Anti-UCP1 antibody
STJ192982	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to UCP1

Ucp1/ Rat Ucp1 ELISA Kit
ELI-06632r	Lifescience Market	96 Tests	EUR 886

Polyclonal UCP1 / UCP-1 Antibody (C-Terminus)
APR10643G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human UCP1 / UCP-1 (C-Terminus). This antibody is tested and proven to work in the following applications:

UCP1 siRNA
20-abx905932	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UCP1 siRNA
20-abx938926	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

UCP1 siRNA
20-abx938927	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

pGEM-UCP1
PVT13596	Lifescience Market	2 ug	EUR 391

anti-UCP1
YF-PA24935	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to UCP1

UCP1 Antibody, HRP conjugated
1-CSB-PA025554LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

UCP1 Antibody, FITC conjugated
1-CSB-PA025554LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

UCP1 Antibody, Biotin conjugated
1-CSB-PA025554LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against UCP1. Recognizes UCP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse)
4-PAF557Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1)

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
4-PAF557Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat)
4-PAF557Ra02	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1)

UCP1 cloning plasmid
CSB-CL025554HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 924 Sequence: ATGGGGGGCCTGACAGCCTCGGACGTACACCCGACCCTGGGGGTCCAGCTCTTCTCAGCTGGAATAGCGGCGTGCTTGGCGGACGTGATCACCTTCCCGCTGGACACGGCCAAAGTCCGGCTCCAGGTCCAAGGTGAATGCCCGACGTCCAGTGTTATTAGGTATAAAGGTGTCCT Show more
Description: A cloning plasmid for the UCP1 gene.

UCP1 Blocking Peptide
DF7720-BP	Affbiotech	1mg	EUR 195

Anti-UCP1 (4E5)
YF-MA16016	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to UCP1

Anti-UCP1 (4B7)
YF-MA16017	Abfrontier	50 ug	EUR 363
Description: Mouse monoclonal to UCP1

Anti-UCP1 (4B7)
YF-MA20450	Abfrontier	200 ul	EUR 363
Description: Mouse monoclonal to UCP1

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC
4-PAF557Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Biotinylated
4-PAF557Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), Cy3
4-PAF557Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), FITC
4-PAF557Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), HRP
4-PAF557Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), PE
4-PAF557Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
4-PAF557Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
4-PAF557Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
4-PAF557Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
4-PAF557Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
4-PAF557Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
4-PAF557Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC
4-PAF557Ra02-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Biotinylated
4-PAF557Ra02-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Biotin.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), Cy3
4-PAF557Ra02-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with Cy3.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), FITC
4-PAF557Ra02-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with FITC.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), HRP
4-PAF557Ra02-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with HRP.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), PE
4-PAF557Ra02-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with PE.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAF557Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAF557Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.

Uncoupling Protein 1, Mitochondrial (UCP1) Polyclonal Antibody (Rat), APC-Cy7
4-PAF557Ra02-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: UCP1 (Pro179~Leu296) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uncoupling Protein 1, Mitochondrial (UCP1). This antibody is labeled with APC-Cy7.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx130224	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx103784	Abbexa	EUR 314.00 EUR 133.00 EUR 829.00 EUR 439.00 EUR 272.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx103785	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx175033	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178804	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178805	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx178806	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody
20-abx210311	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Rat UCP1 shRNA Plasmid
20-abx984681	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human UCP1 ELISA Kit
ELA-E2067h	Lifescience Market	96 Tests	EUR 824

Bovine UCP1 ELISA KIT
ELI-06629b	Lifescience Market	96 Tests	EUR 928

Mouse Ucp1 ELISA KIT
ELI-06630m	Lifescience Market	96 Tests	EUR 865

Canine UCP1 ELISA KIT
ELI-06633d	Lifescience Market	96 Tests	EUR 928

Human UCP1 ELISA KIT
ELI-06634h	Lifescience Market	96 Tests	EUR 824

UCP1 ELISA KIT|Human
EF006166	Lifescience Market	96 Tests	EUR 689

Human UCP1 shRNA Plasmid
20-abx955025	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse UCP1 shRNA Plasmid
20-abx973301	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

UCP1 Recombinant Protein (Human)
RP044629	ABM	100 ug	Ask for price

UCP1 Recombinant Protein (Rat)
RP235742	ABM	100 ug	Ask for price

UCP1 Recombinant Protein (Mouse)
RP182945	ABM	100 ug	Ask for price

pGEM-Ucp1-A8G-m
PVT14024	Lifescience Market	2 ug	EUR 391

Mouse UCP1 ELISA Kit
STJ150299	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of UCP-1 in Mouse serum, plasma and other biological fluids

Rabbit Mitochondrial brown fat uncoupling protein 1, UCP1 ELISA
ELI-06631Ra	Lifescience Market	96 Tests	EUR 928

Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 1
UCP11-S	Alpha Diagnostics	100 ul	EUR 457

Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) antiserum # 2
UCP12-S	Alpha Diagnostics	100 ul	EUR 457

Monoclonal UCP1 Antibody (monoclonal) (M01), Clone: 4E6
APR10646G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4E6. This antibody is applicable in WB, E

Monoclonal UCP1 Antibody (monoclonal) (M03), Clone: 4B7
APR10647G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human UCP1 (monoclonal) (M03). The antibodies are raised in mouse and are from clone 4B7. This antibody is applicable in WB, E

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (FITC)
20-abx273880	Abbexa	EUR 495.00 EUR 258.00 EUR 1455.00 EUR 676.00 EUR 398.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin)
20-abx272849	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Uncoupling Protein 1, Mitochondrial (UCP1) Antibody (Biotin)
20-abx273298	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

m UCP1 inducible lentiviral particles
LVP905	GenTarget	1x107 IFU/ml x 200ul	EUR 451
Description: Pre-made over-expression lentivirus for expressing mouse target: UCP1 (uncoupling protein 1, mitochondrial, proton carrier), [alternative names: AI385626; Slc25a7; Ucp]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_009463. It also contains a RFP-Blasticidin dual selection marker.

Ucp1 ORF Vector (Rat) (pORF)
ORF078582	ABM	1.0 ug DNA	EUR 506

UCP1 ORF Vector (Human) (pORF)
ORF014877	ABM	1.0 ug DNA	EUR 95

Ucp1 ORF Vector (Mouse) (pORF)
ORF060983	ABM	1.0 ug DNA	EUR 506

UCP1 ELISA Kit (Rat) (OKAN05217)
OKAN05217	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: plays a role in heat production by uncoupling oxidative phosphorylation from the respiratory chain [RGD, Feb 2006];Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.119 ng/mL

UCP1 ELISA Kit (Human) (OKAN05445)
OKAN05445	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL

UCP1 ELISA Kit (Mouse) (OKAN05870)
OKAN05870	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

UCP1 ELISA Kit (Mouse) (OKCD02970)
OKCD02970	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.057 ng/mL

UCP1 ELISA Kit (Human) (OKCD08810)
OKCD08810	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Mitochondrial uncoupling proteins (UCP) are members of the family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. Tissue specificity occurs for the different UCPs and the exact methods of how UCPs transfer H+/OH- are not known. UCPs contain the three homologous protein domains of MACPs. This gene is expressed only in brown adipose tissue, a specialized tissue which functions to produce heat.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.064ng/mL

UCP1 ELISA Kit (Rat) (OKCD08811)
OKCD08811	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: plays a role in heat production by uncoupling oxidative phosphorylation from the respiratory chain.;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.119ng/mL

UCP1 ELISA Kit (Rat) (OKEH03446)
OKEH03446	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: UCP are mitochondrial transporter proteins that create proton leaks across the inner mitochondrial membrane, thus uncoupling oxidative phosphorylation from ATP synthesis. As a result, energy is dissipated in the form of heat.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.091 ng/mL

UCP1 ELISA Kit (Rat) (OKCA01905)
OKCA01905	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 7.81 pg/mL

UCP1 ELISA Kit (Mouse) (OKEH07201)
OKEH07201	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Mitochondrial protein responsible for thermogenic respiration, a specialized capacity of brown adipose tissue and beige fat that participates to non-shivering adaptive thermogenesis to temperature and diet variations and more generally to the regulation of energy balance. Functions as a long-chain fatty acid/LCFA and proton symporter, simultaneously transporting one LCFA and one proton through the inner mitochondrial membrane. However, LCFAs remaining associated with the transporter via their hydrophobic tails, it results in an apparent transport of protons activated by LCFAs. Thereby, dissipates the mitochondrial proton gradient and converts the energy of substrate oxydation into heat instead of ATP. Regulates the production of reactive oxygen species/ROS by mitochondria.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 40.5 pg/mL

UCP1 ELISA Kit (Dog) (OKEH08476)
OKEH08476	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34pg/mL

ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
KTE90123-48T	Abbkine	48T	EUR 354
Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
KTE90123-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1)
KTE90123-96T	Abbkine	96T	EUR 572
Description: Quantitative sandwich ELISA for measuring Rabbit Mitochondrial brown fat uncoupling protein 1 (UCP1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) IgG # 1, aff pure
UCP11-A	Alpha Diagnostics	100 ul	EUR 482

Rabbit Anti-Mouse Uncoupling Protein 1 (UCP1) IgG #2, aff pure
UCP12-A	Alpha Diagnostics	100 ug	EUR 482

Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
20-abx004494	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
20-abx005463	Abbexa	EUR 495.00 EUR 356.00	100 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
20-abx320419	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
20-abx322345	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
abx219236-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
abx433424-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody
abx239227-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

UCP1 sgRNA CRISPR Lentivector set (Human)
K2581701	ABM	3 x 1.0 ug	EUR 339

Ucp1 sgRNA CRISPR Lentivector set (Mouse)
K3728401	ABM	3 x 1.0 ug	EUR 339

Ucp1 sgRNA CRISPR Lentivector set (Rat)
K7526001	ABM	3 x 1.0 ug	EUR 339

Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
4-RPF557Mu01	Cloud-Clone	EUR 494.24 EUR 235.00 EUR 1578.40 EUR 592.80 EUR 1085.60 EUR 394.00 EUR 3796.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P12242 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.3kDa Isoelectric Point: 7.7
Description: Recombinant Mouse Uncoupling Protein 1, Mitochondrial expressed in: E.coli

Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
4-RPF557Ra01	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04633 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 14.6kDa Isoelectric Point: Inquire
Description: Recombinant Rat Uncoupling Protein 1, Mitochondrial expressed in: E.coli

Recombinant Uncoupling Protein 1, Mitochondrial (UCP1)
4-RPF557Ra02	Cloud-Clone	EUR 490.66 EUR 234.00 EUR 1564.96 EUR 588.32 EUR 1076.64 EUR 391.00 EUR 3762.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P04633 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 45.0kDa Isoelectric Point: Inquire
Description: Recombinant Rat Uncoupling Protein 1, Mitochondrial expressed in: E.coli

Mitochondrial Brown Fat Uncoupling Protein 1 (UCP1) Antibody (Biotin)
20-abx105665	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

VEGF Rabbit Polyclonal Antibody
ES8453-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

CD10 Rabbit Polyclonal Antibody
ES8454-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NM23A Rabbit Polyclonal Antibody
ES8455-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8456-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATM Rabbit Polyclonal Antibody
ES8457-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSC70 Rabbit Polyclonal Antibody
ES8558-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP40 Rabbit Polyclonal Antibody
ES8559-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

HSP90? Rabbit Polyclonal Antibody
ES8560-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

IkB ? Rabbit Polyclonal Antibody
ES8561-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK1 Rabbit Polyclonal Antibody
ES8562-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JAK2 Rabbit Polyclonal Antibody
ES8563-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK2 Rabbit Polyclonal Antibody
ES8564-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

JNK3 Rabbit Polyclonal Antibody
ES8565-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK2 Rabbit Polyclonal Antibody
ES8566-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

MEK3 Rabbit Polyclonal Antibody
ES8567-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

Nrf2 Rabbit Polyclonal Antibody
ES8568-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4a Rabbit Polyclonal Antibody
ES8569-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4b Rabbit Polyclonal Antibody
ES8570-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG4c Rabbit Polyclonal Antibody
ES8571-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG5 Rabbit Polyclonal Antibody
ES8572-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG7 Rabbit Polyclonal Antibody
ES8573-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8574-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG13 Rabbit Polyclonal Antibody
ES8575-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

ATG14L Rabbit Polyclonal Antibody
ES8576-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8578-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

NBR1 Rabbit Polyclonal Antibody
ES8579-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

WIPI2 Rabbit Polyclonal Antibody
ES8580-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

UCP1 Rabbit Polyclonal Antibody