GSTM2 Rabbit Polyclonal Antibody

GSTM2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GSTM2 Polyclonal Antibody
ES11906-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GSTM2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GSTM2 Polyclonal Antibody
ES11906-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GSTM2 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GSTM2 Rabbit pAb
A13496-100ul	Abclonal	100 ul	EUR 308

GSTM2 Rabbit pAb
A13496-200ul	Abclonal	200 ul	EUR 459

GSTM2 Rabbit pAb
A13496-20ul	Abclonal	20 ul	EUR 183

GSTM2 Rabbit pAb
A13496-50ul	Abclonal	50 ul	EUR 223

GSTM2 antibody
70R-2848	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal GSTM2 antibody

GSTM2 Antibody
32228-100ul	SAB	100ul	EUR 252

GSTM2 Antibody
43377-100ul	SAB	100ul	EUR 252

GSTM2 Antibody
DF6339	Affbiotech	200ul	EUR 304
Description: GSTM2 Antibody detects endogenous levels of total GSTM2.

GSTM2 antibody
70R-49834	Fitzgerald	100 ul	EUR 244
Description: Purified Polyclonal GSTM2 antibody

GSTM2 Antibody
CSB-PA009981KA01HU-	Cusabio		EUR 335
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GSTM2. Recognizes GSTM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GSTM2 Antibody
CSB-PA009981KA01HU-100ul	Cusabio	100ul	EUR 389
Form: liquid Buffer: Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Affinity purification
Description: A polyclonal antibody against GSTM2. Recognizes GSTM2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:2000, IHC:1:50-1:200

GSTM2 Antibody
ABD6339	Lifescience Market	100 ug	EUR 438

Polyclonal Goat Anti-GSTM1 / GSTM2 Antibody
AMM05005G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GSTM1 / GSTM2 . This antibody is tested and proven to work in the following applications:

Human GSTM2 Antibody
33169-05111	AssayPro	150 ug	EUR 261

GSTM2 Conjugated Antibody
C43377	SAB	100ul	EUR 397

GSTM2 Conjugated Antibody
C32228	SAB	100ul	EUR 397

Anti-GSTM2 antibody
STJ115457	St John's Laboratory	100 µl	EUR 277
Description: Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs.

Anti-GSTM2 antibody
STJ193064	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GSTM2

Gstm2/ Rat Gstm2 ELISA Kit
ELI-27914r	Lifescience Market	96 Tests	EUR 886

GSTM2 siRNA
20-abx902354	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTM2 siRNA
20-abx918820	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

GSTM2 siRNA
20-abx918821	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Anti-GSTM1 / GSTM2 antibody
STJ70642	St John's Laboratory	100 µg	EUR 359

GSTM2 Blocking Peptide
33R-9250	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of GSTM2 antibody, catalog no. 70R-2848

GSTM2 Blocking Peptide
DF6339-BP	Affbiotech	1mg	EUR 195

GSTM2 Blocking Peptide
20-abx062709	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

GSTM2 cloning plasmid
CSB-CL009981HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 657 Sequence: ATGCCCATGACACTGGGGTACTGGAACATCCGCGGGCTGGCCCATTCCATCCGCCTGCTCCTGGAATACACAGACTCAAGCTACGAGGAAAAGAAGTACACGATGGGGGACGCTCCTGATTATGACAGAAGCCAGTGGCTGAATGAAAAATTCAAGCTGGGCCTGGACTTTCCCAA Show more
Description: A cloning plasmid for the GSTM2 gene.

Anti-GSTM2 (1E10)
YF-MA10392	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to GSTM2

Human GSTM2 Antibody (Biotin Conjugate)
33169-05121	AssayPro	150 ug	EUR 369

Human GSTM2 AssayLite Antibody (FITC Conjugate)
33169-05141	AssayPro	150 ug	EUR 428

Human GSTM2 AssayLite Antibody (RPE Conjugate)
33169-05151	AssayPro	150 ug	EUR 428

Human GSTM2 AssayLite Antibody (APC Conjugate)
33169-05161	AssayPro	150 ug	EUR 428

Human GSTM2 AssayLite Antibody (PerCP Conjugate)
33169-05171	AssayPro	150 ug	EUR 471

GSTM2 protein (His tag)
80R-1490	Fitzgerald	100 ug	EUR 305
Description: Purified recombinant Human GSTM2 protein

Rat GSTM2 shRNA Plasmid
20-abx984489	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human GSTM2 shRNA Plasmid
20-abx951991	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse GSTM2 shRNA Plasmid
20-abx970690	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GSTM2 Recombinant Protein (Human)
RP039664	ABM	100 ug	Ask for price

GSTM2 Recombinant Protein (Rat)
RP203852	ABM	100 ug	Ask for price

GSTM2 Recombinant Protein (Mouse)
RP140255	ABM	100 ug	Ask for price

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse)
4-PAA657Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2)

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat)
4-PAA657Ra01	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2)

Rabbit Glutathione S Transferase Mu 2 (GSTM2) ELISA Kit
abx362484-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), APC
4-PAA657Mu01-APC	Cloud-Clone	EUR 329.00 EUR 3041.00 EUR 854.00 EUR 416.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), Biotinylated
4-PAA657Mu01-Biotin	Cloud-Clone	EUR 299.00 EUR 2288.00 EUR 684.00 EUR 363.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), Cy3
4-PAA657Mu01-Cy3	Cloud-Clone	EUR 397.00 EUR 4013.00 EUR 1097.00 EUR 513.00 EUR 241.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), FITC
4-PAA657Mu01-FITC	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), HRP
4-PAA657Mu01-HRP	Cloud-Clone	EUR 302.00 EUR 2652.00 EUR 756.00 EUR 377.00 EUR 200.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), PE
4-PAA657Mu01-PE	Cloud-Clone	EUR 283.00 EUR 2452.00 EUR 703.00 EUR 353.00 EUR 189.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), APC
4-PAA657Ra01-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), Biotinylated
4-PAA657Ra01-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), Cy3
4-PAA657Ra01-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), FITC
4-PAA657Ra01-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), HRP
4-PAA657Ra01-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), PE
4-PAA657Ra01-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
20-abx009183	Abbexa	EUR 300.00 EUR 439.00 EUR 189.00	100 ul 200 ul 30 ul
Shipped within 5-10 working days.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
abx117065-100ug	Abbexa	100 ug	EUR 467
Shipped within 5-10 working days.

Glutathione S Transferase Mu 2 (GSTM2) Antibody
abx340199-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Monoclonal GSTM2 Antibody (clone 1E10), Clone: 1E10
AMM05250G	Leading Biology	0.05mg	EUR 528
Description: A Monoclonal antibody against Human GSTM2 (clone 1E10). The antibodies are raised in Mouse and are from clone 1E10. This antibody is applicable in WB and IHC-P, E

Glutathione S Transferase Mu 2 (GSTM2) Antibody
20-abx001119	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Gstm2 ORF Vector (Rat) (pORF)
ORF067952	ABM	1.0 ug DNA	EUR 506

GSTM2 ORF Vector (Human) (pORF)
ORF013222	ABM	1.0 ug DNA	EUR 354

Gstm2 ORF Vector (Mouse) (pORF)
ORF046753	ABM	1.0 ug DNA	EUR 506

GSTM2 ELISA Kit (Human) (OKCA01257)
OKCA01257	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.078 ng/mL

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAA657Mu01-APC-Cy7	Cloud-Clone	EUR 538.00 EUR 5962.00 EUR 1588.00 EUR 713.00 EUR 304.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Leu5~Arg202) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Rat), APC-Cy7
4-PAA657Ra01-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met1~Lys218) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC-Cy7.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104058	Abbexa	EUR 398.00 EUR 133.00 EUR 1107.00 EUR 537.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104059	Abbexa	EUR 411.00 EUR 133.00 EUR 1135.00 EUR 551.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx104060	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody
20-abx172617	Abbexa	EUR 787.00 EUR 411.00	1 mg 200 ug
Please enquire.

Gstm2 sgRNA CRISPR Lentivector set (Rat)
K6893201	ABM	3 x 1.0 ug	EUR 339

Gstm2 sgRNA CRISPR Lentivector set (Mouse)
K3274801	ABM	3 x 1.0 ug	EUR 339

GSTM2 sgRNA CRISPR Lentivector set (Human)
K0913701	ABM	3 x 1.0 ug	EUR 339

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig)
4-PAA657Hu01	Cloud-Clone	EUR 232.00 EUR 2285.00 EUR 574.00 EUR 289.00 EUR 208.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2)

Glutathione S Transferase Mu 2, Muscle (GSTm2) Antibody (Biotin)
20-abx273314	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), APC
4-PAA657Hu01-APC	Cloud-Clone	EUR 323.00 EUR 2969.00 EUR 836.00 EUR 409.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with APC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Biotinylated
4-PAA657Hu01-Biotin	Cloud-Clone	EUR 295.00 EUR 2235.00 EUR 671.00 EUR 358.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Biotin.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), Cy3
4-PAA657Hu01-Cy3	Cloud-Clone	EUR 390.00 EUR 3917.00 EUR 1073.00 EUR 504.00 EUR 239.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with Cy3.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), FITC
4-PAA657Hu01-FITC	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with FITC.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), HRP
4-PAA657Hu01-HRP	Cloud-Clone	EUR 297.00 EUR 2589.00 EUR 741.00 EUR 371.00 EUR 199.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with HRP.

Glutathione S Transferase Mu 2, Muscle (GSTm2) Polyclonal Antibody (Human, Mouse, Rat, Pig), PE
4-PAA657Hu01-PE	Cloud-Clone	EUR 279.00 EUR 2395.00 EUR 688.00 EUR 347.00 EUR 188.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: GSTm2 (Met3~Lys218) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse, Rat, Pig Glutathione S Transferase Mu 2, Muscle (GSTm2). This antibody is labeled with PE.

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6893202	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6893203	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6893204	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3274802	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3274803	ABM	1.0 ug DNA	EUR 154

Gstm2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3274804	ABM	1.0 ug DNA	EUR 154

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0913702	ABM	1.0 ug DNA	EUR 154

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0913703	ABM	1.0 ug DNA	EUR 154

GSTM2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0913704	ABM	1.0 ug DNA	EUR 154

GSTM2 Protein Vector (Rat) (pPB-C-His)
PV271806	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Rat) (pPB-N-His)
PV271807	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Rat) (pPM-C-HA)
PV271808	ABM	500 ng	EUR 603

GSTM2 Protein Vector (Rat) (pPM-C-His)
PV271809	ABM	500 ng	EUR 603

GSTM2 Rabbit Polyclonal Antibody