WDFY1 Rabbit Polyclonal Antibody

WDFY1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    WDFY1 Polyclonal Antibody
    ABP60912-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human WDFY1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of WDFY1 from Human. This WDFY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WDFY1 protein
    WDFY1 Polyclonal Antibody
    ES11743-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WDFY1 from . This antibody is tested and validated for WB, ELISA, WB, ELISA
    WDFY1 Polyclonal Antibody
    ES11743-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against WDFY1 from . This antibody is tested and validated for WB, ELISA, WB, ELISA
    WDFY1 Antibody
    46708-100ul 100ul
    EUR 252
    WDFY1 Antibody
    1-CSB-PA816890LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000
    WDFY1 antibody
    70R-4012 50 ug
    EUR 467
    Description: Rabbit polyclonal WDFY1 antibody raised against the N terminal of WDFY1
    Polyclonal WDFY1 antibody - N-terminal region
    AMM08508G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WDFY1 - N-terminal region. This antibody is tested and proven to work in the following applications:
    Polyclonal FENS1 / WDFY1 Antibody (C-Term)
    APR15946G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FENS1 / WDFY1 (C-Term). This antibody is tested and proven to work in the following applications:
    WDFY1 Conjugated Antibody
    C46708 100ul
    EUR 397
    WDFY1 Antibody (HRP)
    20-abx315463
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    WDFY1 Antibody (FITC)
    20-abx315464
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    WDFY1 Antibody (Biotin)
    20-abx315465
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Anti-WDFY1 antibody
    STJ192901 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to WDFY1
    WDFY1 siRNA
    20-abx939669
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    WDFY1 Antibody, HRP conjugated
    1-CSB-PA816890LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    WDFY1 Antibody, FITC conjugated
    1-CSB-PA816890LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    WDFY1 Antibody, Biotin conjugated
    1-CSB-PA816890LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Anti-FENS1 / WDFY1 antibody
    STJ70535 100 µg
    EUR 260
    WDFY1 Blocking Peptide
    33R-5591 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WDFY1 antibody, catalog no. 70R-4012
    WDFY1 cloning plasmid
    CSB-CL816890HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1233
    • Sequence: atggcggccgaaatccactccaggccgcagagcagccgcccggtgctgctgagcaagatcgaggggcaccaggacgccgtcacggccgcgctgctcatccccaaggaggacggcgtgatcacggccagcgaggacagaaccatccgggtatggctgaaaagagacagtggtcaat
    • Show more
    Description: A cloning plasmid for the WDFY1 gene.
    Bovine WDFY1 ELISA KIT
    ELI-16956b 96 Tests
    EUR 928
    Human WDFY1 ELISA KIT
    ELI-28737h 96 Tests
    EUR 824
    Human WDFY1 shRNA Plasmid
    20-abx961562
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    WDFY1 Recombinant Protein (Rat)
    RP237194 100 ug Ask for price
    WDFY1 Recombinant Protein (Human)
    RP034543 100 ug Ask for price
    WDFY1 Recombinant Protein (Mouse)
    RP185174 100 ug Ask for price
    WDFY1 Recombinant Protein (Mouse)
    RP185177 100 ug Ask for price
    Wdfy1 ORF Vector (Mouse) (pORF)
    ORF061726 1.0 ug DNA
    EUR 506
    Wdfy1 ORF Vector (Mouse) (pORF)
    ORF061727 1.0 ug DNA
    EUR 506
    Wdfy1 ORF Vector (Rat) (pORF)
    ORF079066 1.0 ug DNA
    EUR 506
    WDFY1 ORF Vector (Human) (pORF)
    ORF011515 1.0 ug DNA
    EUR 95
    Wdfy1 sgRNA CRISPR Lentivector set (Rat)
    K7187501 3 x 1.0 ug
    EUR 339
    WDFY1 sgRNA CRISPR Lentivector set (Human)
    K2627801 3 x 1.0 ug
    EUR 339
    Wdfy1 sgRNA CRISPR Lentivector set (Mouse)
    K4557001 3 x 1.0 ug
    EUR 339
    Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7187502 1.0 ug DNA
    EUR 154
    Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7187503 1.0 ug DNA
    EUR 154
    Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7187504 1.0 ug DNA
    EUR 154
    WDFY1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K2627802 1.0 ug DNA
    EUR 154
    WDFY1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K2627803 1.0 ug DNA
    EUR 154
    WDFY1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K2627804 1.0 ug DNA
    EUR 154
    Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4557002 1.0 ug DNA
    EUR 154
    Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4557003 1.0 ug DNA
    EUR 154
    Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4557004 1.0 ug DNA
    EUR 154
    WDFY1 Protein Vector (Mouse) (pPB-C-His)
    PV246902 500 ng
    EUR 603
    WDFY1 Protein Vector (Mouse) (pPB-N-His)
    PV246903 500 ng
    EUR 603
    WDFY1 Protein Vector (Mouse) (pPM-C-HA)
    PV246904 500 ng
    EUR 603

    WDFY1 Rabbit Polyclonal Antibody