WDFY1 Rabbit Polyclonal Antibody

WDFY1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

WDFY1 Polyclonal Antibody
ABP60912-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human WDFY1 protein Applications tips:
Description: A polyclonal antibody for detection of WDFY1 from Human. This WDFY1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human WDFY1 protein

WDFY1 Polyclonal Antibody
ES11743-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against WDFY1 from . This antibody is tested and validated for WB, ELISA, WB, ELISA

WDFY1 Polyclonal Antibody
ES11743-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against WDFY1 from . This antibody is tested and validated for WB, ELISA, WB, ELISA

WDFY1 Antibody
46708-100ul	SAB	100ul	EUR 252

WDFY1 Antibody
1-CSB-PA816890LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

WDFY1 antibody
70R-4012	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal WDFY1 antibody raised against the N terminal of WDFY1

Polyclonal WDFY1 antibody - N-terminal region
AMM08508G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human WDFY1 - N-terminal region. This antibody is tested and proven to work in the following applications:

Polyclonal FENS1 / WDFY1 Antibody (C-Term)
APR15946G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human FENS1 / WDFY1 (C-Term). This antibody is tested and proven to work in the following applications:

WDFY1 Conjugated Antibody
C46708	SAB	100ul	EUR 397

WDFY1 Antibody (HRP)
20-abx315463	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

WDFY1 Antibody (FITC)
20-abx315464	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

WDFY1 Antibody (Biotin)
20-abx315465	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-WDFY1 antibody
STJ192901	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to WDFY1

WDFY1 siRNA
20-abx939669	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

WDFY1 Antibody, HRP conjugated
1-CSB-PA816890LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

WDFY1 Antibody, FITC conjugated
1-CSB-PA816890LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

WDFY1 Antibody, Biotin conjugated
1-CSB-PA816890LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against WDFY1. Recognizes WDFY1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-FENS1 / WDFY1 antibody
STJ70535	St John's Laboratory	100 µg	EUR 260

WDFY1 Blocking Peptide
33R-5591	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of WDFY1 antibody, catalog no. 70R-4012

WDFY1 cloning plasmid
CSB-CL816890HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1233 Sequence: atggcggccgaaatccactccaggccgcagagcagccgcccggtgctgctgagcaagatcgaggggcaccaggacgccgtcacggccgcgctgctcatccccaaggaggacggcgtgatcacggccagcgaggacagaaccatccgggtatggctgaaaagagacagtggtcaat Show more
Description: A cloning plasmid for the WDFY1 gene.

Bovine WDFY1 ELISA KIT
ELI-16956b	Lifescience Market	96 Tests	EUR 928

Human WDFY1 ELISA KIT
ELI-28737h	Lifescience Market	96 Tests	EUR 824

Human WDFY1 shRNA Plasmid
20-abx961562	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

WDFY1 Recombinant Protein (Rat)
RP237194	ABM	100 ug	Ask for price

WDFY1 Recombinant Protein (Human)
RP034543	ABM	100 ug	Ask for price

WDFY1 Recombinant Protein (Mouse)
RP185174	ABM	100 ug	Ask for price

WDFY1 Recombinant Protein (Mouse)
RP185177	ABM	100 ug	Ask for price

Wdfy1 ORF Vector (Mouse) (pORF)
ORF061726	ABM	1.0 ug DNA	EUR 506

Wdfy1 ORF Vector (Mouse) (pORF)
ORF061727	ABM	1.0 ug DNA	EUR 506

Wdfy1 ORF Vector (Rat) (pORF)
ORF079066	ABM	1.0 ug DNA	EUR 506

WDFY1 ORF Vector (Human) (pORF)
ORF011515	ABM	1.0 ug DNA	EUR 95

Wdfy1 sgRNA CRISPR Lentivector set (Rat)
K7187501	ABM	3 x 1.0 ug	EUR 339

WDFY1 sgRNA CRISPR Lentivector set (Human)
K2627801	ABM	3 x 1.0 ug	EUR 339

Wdfy1 sgRNA CRISPR Lentivector set (Mouse)
K4557001	ABM	3 x 1.0 ug	EUR 339

Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7187502	ABM	1.0 ug DNA	EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7187503	ABM	1.0 ug DNA	EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7187504	ABM	1.0 ug DNA	EUR 154

WDFY1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2627802	ABM	1.0 ug DNA	EUR 154

WDFY1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2627803	ABM	1.0 ug DNA	EUR 154

WDFY1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2627804	ABM	1.0 ug DNA	EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K4557002	ABM	1.0 ug DNA	EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K4557003	ABM	1.0 ug DNA	EUR 154

Wdfy1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K4557004	ABM	1.0 ug DNA	EUR 154

WDFY1 Protein Vector (Mouse) (pPB-C-His)
PV246902	ABM	500 ng	EUR 603

WDFY1 Protein Vector (Mouse) (pPB-N-His)
PV246903	ABM	500 ng	EUR 603

WDFY1 Protein Vector (Mouse) (pPM-C-HA)
PV246904	ABM	500 ng	EUR 603

WDFY1 Rabbit Polyclonal Antibody