MYH1 Rabbit Polyclonal Antibody

MYH1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

MYH1 Polyclonal Antibody
ABP59360-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human MYH1 protein Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody
ABP59360-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MYH1 protein Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Polyclonal Antibody
ABP59360-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MYH1 protein Applications tips:
Description: A polyclonal antibody for detection of MYH1 from Human, Mouse. This MYH1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MYH1 protein

MYH1 Rabbit pAb
A6935-100ul	Abclonal	100 ul	EUR 308

MYH1 Rabbit pAb
A6935-200ul	Abclonal	200 ul	EUR 459

MYH1 Rabbit pAb
A6935-20ul	Abclonal	20 ul	EUR 183

MYH1 Rabbit pAb
A6935-50ul	Abclonal	50 ul	EUR 223

MYH1 antibody
70R-3929	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal MYH1 antibody raised against the N terminal of MYH1

MYH1 Antibody
35828-100ul	SAB	100ul	EUR 252

MYH1 Antibody
31804-100ul	SAB	100ul	EUR 252

MYH1 Antibody
1-CSB-PA877584	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

MYH1 Antibody
1-CSB-PA791340	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:50-1:200

MYH1 Antibody
1-CSB-PA015289ESR1HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MYH1. Recognizes MYH1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
DLR-MYH1-Hu-48T	DL Develop	48T	EUR 479
Should the Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
DLR-MYH1-Hu-96T	DL Develop	96T	EUR 621
Should the Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
DLR-MYH1-Mu-48T	DL Develop	48T	EUR 489
Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
DLR-MYH1-Mu-96T	DL Develop	96T	EUR 635
Should the Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RD-MYH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 478

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RD-MYH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 662

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RD-MYH1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 489

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RD-MYH1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 677

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RDR-MYH1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 500

Human Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RDR-MYH1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 692

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RDR-MYH1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 511

Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) ELISA Kit
RDR-MYH1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 709

MYH1 Conjugated Antibody
C35828	SAB	100ul	EUR 397

MYH1 Conjugated Antibody
C31804	SAB	100ul	EUR 397

anti- MYH1 antibody
FNab05469	FN Test	100µg	EUR 585
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 IF: 1:50 - 1:100 Immunogen: myosin, heavy chain 1, skeletal muscle, adult Uniprot ID: P12882 Gene ID: 4619 Research Area: Cancer, Immunology, Developmental biology
Description: Antibody raised against MYH1

anti- MYH1 antibody
FNab05470	FN Test	100µg	EUR 548.75
Immunogen: myosin, heavy chain 1, skeletal muscle, adult Uniprot ID: P12882 Gene ID: 4619 Research Area: Cancer, Immunology, Developmental biology
Description: Antibody raised against MYH1

Anti-MYH1 antibody
PAab05469	Lifescience Market	100 ug	EUR 412

Anti-MYH1 antibody
PAab05470	Lifescience Market	100 ug	EUR 386

Anti-MYH1 antibody
STJ29015	St John's Laboratory	100 µl	EUR 277
Description: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin heavy chains are encoded by a multigene family. In mammals at least 10 different myosin heavy chain (MYH) isoforms have been described from striated, smooth, and nonmuscle cells. These isoforms show expression that is spatially and temporally regulated during development.

Anti-MYH1 antibody
STJ193139	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MYH1

Myosin heavy polypeptide 1 (MYH1) polyclonal antibody
ABP-PAB-01616	Allele Biotech	100 ug	Ask for price
Product line: Miscellaneous Brand:

Rabbit Myosin 1(MYH1) ELISA kit
E04M0413-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit
E04M0413-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Myosin 1(MYH1) ELISA kit
E04M0413-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Myosin 1(MYH1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

MYH1 siRNA
20-abx925144	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYH1 siRNA
20-abx925145	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MYH1 cloning plasmid
CSB-CL015289HU-10ug	Cusabio	10ug	EUR 2770
Formulation: 10 μg plasmid + 200μl Glycerol Length: 5820 Sequence: ATGAGTTCTGACTCTGAGATGGCCATTTTTGGGGAGGCTGCTCCTTTCCTCCGAAAGTCTGAAAGGGAGCGAATTGAAGCCCAGAACAAGCCTTTTGATGCCAAGACATCAGTCTTTGTGGTGGACCCTAAGGAGTCCTTTGTGAAAGCAACAGTGCAGAGCAGGGAAGGGGGGA Show more
Description: A cloning plasmid for the MYH1 gene.

MYH1 Blocking Peptide
33R-4695	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of MYH1 antibody, catalog no. 70R-3929

Human MYH1 ELISA Kit
ELA-E0161h	Lifescience Market	96 Tests	EUR 824

MYH1 ELISA KIT|Human
EF000470	Lifescience Market	96 Tests	EUR 689

Human MYH1 shRNA Plasmid
20-abx953047	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse MYH1 shRNA Plasmid
20-abx971645	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1) Polyclonal Antibody (Mouse)
4-PAA754Mu01	Cloud-Clone	EUR 236.00 EUR 2338.00 EUR 586.00 EUR 294.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: MYH1 (RTKY+Glu1585~Met1642) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Myosin Heavy Chain 1, Skeletal Muscle, Adult (MYH1)

Myh1 ORF Vector (Mouse) (pORF)
ORF050850	ABM	1.0 ug DNA	EUR 1572

Myh1 ORF Vector (Rat) (pORF)
ORF070975	ABM	1.0 ug DNA	EUR 2080

MYH1 ORF Vector (Human) (pORF)
ORF013840	ABM	1.0 ug DNA	EUR 354

MYH1 ELISA Kit (Human) (OKCD06765)
OKCD06765	Aviva Systems Biology	96 Wells	EUR 753
Description: Description of target: Myosin is a major contractile protein which converts chemical energy into mechanical energy through the hydrolysis of ATP. Myosin is a hexameric protein composed of a pair of myosin heavy chains (MYH) and two pairs of nonidentical light chains. Myosin hea;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.059ng/mL

MYH1 ELISA Kit (Mouse) (OKCD02740)
OKCD02740	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Muscle contraction. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.2 pg/mL

MYH1 ELISA Kit (Mouse) (OKCD09540)
OKCD09540	Aviva Systems Biology	96 Wells	EUR 740
Description: Description of target: Muscle contraction. ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.137ng/mL.

MYH1 ELISA Kit (Pig) (OKEH03815)
OKEH03815	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Muscle contraction.;Species reactivity: Pig;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 35 pg/mL

MYH1 ELISA Kit (Bovine) (OKEH03816)
OKEH03816	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: Muscle contraction.;Species reactivity: Bovine;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.064 ng/mL

MYH1 Rabbit Polyclonal Antibody