TXLNA Rabbit Polyclonal Antibody

TXLNA Rabbit Polyclonal Antibody

Contact Us Below To Order :

    TXLNA Polyclonal Antibody
    ABP60797-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human TXLNA protein
    • Applications tips:
    Description: A polyclonal antibody for detection of TXLNA from Human, Mouse. This TXLNA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TXLNA protein
    TXLNA Polyclonal Antibody
    ES11788-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against TXLNA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    TXLNA Polyclonal Antibody
    ES11788-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against TXLNA from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    Human Taxilin Alpha (TXLNa) ELISA Kit
    DLR-TXLNa-Hu-48T 48T
    EUR 498
    • Should the Human Taxilin Alpha (TXLNa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Taxilin Alpha (TXLNa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Taxilin Alpha (TXLNa) ELISA Kit
    DLR-TXLNa-Hu-96T 96T
    EUR 647
    • Should the Human Taxilin Alpha (TXLNa) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Taxilin Alpha (TXLNa) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids.
    Human Taxilin Alpha (TXLNa) ELISA Kit
    RDR-TXLNa-Hu-48Tests 48 Tests
    EUR 522
    Human Taxilin Alpha (TXLNa) ELISA Kit
    RDR-TXLNa-Hu-96Tests 96 Tests
    EUR 724
    Human Taxilin Alpha (TXLNa) ELISA Kit
    RD-TXLNa-Hu-48Tests 48 Tests
    EUR 500
    Human Taxilin Alpha (TXLNa) ELISA Kit
    RD-TXLNa-Hu-96Tests 96 Tests
    EUR 692
    TXLNA Rabbit pAb
    A18291-100ul 100 ul
    EUR 308
    TXLNA Rabbit pAb
    A18291-200ul 200 ul
    EUR 459
    TXLNA Rabbit pAb
    A18291-20ul 20 ul
    EUR 183
    TXLNA Rabbit pAb
    A18291-50ul 50 ul
    EUR 223
    Rabbit TXLNa ELISA Kit
    ERTT0382 96Tests
    EUR 521
    TXLNA Antibody
    36551-100ul 100ul
    EUR 252
    TXLNA Antibody
    1-CSB-PA843964
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against TXLNA. Recognizes TXLNA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
    TXLNA Antibody
    1-CSB-PA234430
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against TXLNA. Recognizes TXLNA from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:2000-1:5000, WB:1:500-1:2000
    TXLNA antibody
    70R-35826 100 ug
    EUR 349
    Description: Rabbit polyclonal TXLNA antibody
    Polyclonal TXLNA Antibody - C-terminal region
    APR01617G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TXLNA - C-terminal region. This antibody is tested and proven to work in the following applications:
    Polyclonal TXLNA Antibody - N-terminal region
    APR01618G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TXLNA - N-terminal region. This antibody is tested and proven to work in the following applications:
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Human)
    4-PAB182Hu01
    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Lys328~Glu531)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa)
    [KO Validated] TXLNA Rabbit pAb
    A19889-100ul 100 ul
    EUR 410
    [KO Validated] TXLNA Rabbit pAb
    A19889-200ul 200 ul
    EUR 571
    [KO Validated] TXLNA Rabbit pAb
    A19889-20ul 20 ul
    EUR 221
    [KO Validated] TXLNA Rabbit pAb
    A19889-50ul 50 ul
    EUR 287
    TXLNA Conjugated Antibody
    C36551 100ul
    EUR 397
    Anti-TXLNA antibody
    STJ11100247 100 µl
    EUR 277
    Anti-TXLNA antibody
    STJ11100765 100 µl
    EUR 413
    Anti-TXLNA antibody
    STJ192946 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to TXLNA
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), APC
    4-PAB182Hu01-APC
    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Lys328~Glu531)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with APC.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), Biotinylated
    4-PAB182Hu01-Biotin
    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Lys328~Glu531)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with Biotin.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), Cy3
    4-PAB182Hu01-Cy3
    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Lys328~Glu531)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with Cy3.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), FITC
    4-PAB182Hu01-FITC
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Lys328~Glu531)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with FITC.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), HRP
    4-PAB182Hu01-HRP
    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Lys328~Glu531)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with HRP.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), PE
    4-PAB182Hu01-PE
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Lys328~Glu531)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with PE.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat)
    4-PAB182Mu01
    • EUR 243.00
    • EUR 2457.00
    • EUR 613.00
    • EUR 305.00
    • EUR 212.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Met1~Ala234)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa)
    Rabbit Alpha-taxilin(TXLNA) ELISA kit
    E04A2018-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Alpha-taxilin(TXLNA) ELISA kit
    E04A2018-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Alpha-taxilin(TXLNA) ELISA kit
    E04A2018-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rabbit Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Taxilin Alpha (TXLNa) ELISA Kit
    abx362715-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    TXLNA siRNA
    20-abx938635
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    TXLNA siRNA
    20-abx938636
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Taxilin Alpha (TXLNA) Antibody
    20-abx213218
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Taxilin Alpha (TXLNA) Antibody
    20-abx213510
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Taxilin Alpha (TXLNA) Antibody
    abx037110-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Taxilin Alpha (TXLNa) Antibody
    20-abx128767
    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Taxilin Alpha (TXLNa) Antibody
    20-abx129547
    • EUR 425.00
    • EUR 133.00
    • EUR 1177.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Taxilin Alpha (TXLNa) Antibody
    20-abx174724
    • EUR 815.00
    • EUR 425.00
    • 1 mg
    • 200 ug
    • Please enquire.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Human), APC-Cy7
    4-PAB182Hu01-APC-Cy7
    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Lys328~Glu531)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human Taxilin Alpha (TXLNa). This antibody is labeled with APC-Cy7.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), APC
    4-PAB182Mu01-APC
    • EUR 340.00
    • EUR 3203.00
    • EUR 894.00
    • EUR 432.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Met1~Ala234)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with APC.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), Biotinylated
    4-PAB182Mu01-Biotin
    • EUR 307.00
    • EUR 2407.00
    • EUR 714.00
    • EUR 375.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Met1~Ala234)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with Biotin.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), Cy3
    4-PAB182Mu01-Cy3
    • EUR 411.00
    • EUR 4229.00
    • EUR 1151.00
    • EUR 535.00
    • EUR 248.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Met1~Ala234)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with Cy3.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), FITC
    4-PAB182Mu01-FITC
    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Met1~Ala234)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with FITC.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), HRP
    4-PAB182Mu01-HRP
    • EUR 311.00
    • EUR 2792.00
    • EUR 791.00
    • EUR 391.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Met1~Ala234)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with HRP.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), PE
    4-PAB182Mu01-PE
    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Met1~Ala234)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with PE.
    TXLNA cloning plasmid
    CSB-CL025363HU1-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1641
    • Sequence: ATGAAGAACCAAGACAAAAAGAACGGGGCTGCCAAACAATCCAATCCAAAAAGCAGCCCAGGACAACCGGAAGCAGGACCCGAGGGAGCCCAGGAGCGGCCCAGCCAGGCGGCTCCTGCAGTAGAAGCAGAAGGTCCCGGCAGCAGCCAGGCTCCTCGGAAGCCGGAGGGGGCTC
    • Show more
    Description: A cloning plasmid for the TXLNA gene.
    TXLNA cloning plasmid
    CSB-CL025363HU2-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1641
    • Sequence: ATGAAGAACCAAGACAAAAAGAACGGGGCTGCCAAACAATCCAATCCAAAAAGCAGCCCAGGACAACCGGAAGCAGGACCCGAGGGAGCCCAGGAGCGGCCCAGCCAGGCGGCTCCTGCAGTAGAAGCAGAAGGTCCCGGCAGCAGCCAGGCTCCTCGGAAGCCGGAGGGGGCTC
    • Show more
    Description: A cloning plasmid for the TXLNA gene.
    Taxilin Alpha (TXLNa) Polyclonal Antibody (Mouse, Rat), APC-Cy7
    4-PAB182Mu01-APC-Cy7
    • EUR 560.00
    • EUR 6286.00
    • EUR 1669.00
    • EUR 745.00
    • EUR 315.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TXLNa (Met1~Ala234)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse, Rat Taxilin Alpha (TXLNa). This antibody is labeled with APC-Cy7.
    Active Taxilin Alpha (TXLNa)
    4-APB182Hu01
    • EUR 777.38
    • EUR 311.00
    • EUR 2640.16
    • EUR 946.72
    • EUR 1793.44
    • EUR 583.00
    • EUR 6450.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P40222
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 27.4kDa
    • Isoelectric Point: 7.8
    Description: Recombinant Human Taxilin Alpha expressed in: Available from E.coli, Yeast, Baculovirus and Mammalian cells
    Human TXLNA ELISA Kit
    EHT0382 96Tests
    EUR 521
    Bovine TXLNA ELISA Kit
    EBT0382 96Tests
    EUR 521
    Anserini TXLNa ELISA Kit
    EAT0382 96Tests
    EUR 521
    Chicken TXLNA ELISA Kit
    ECKT0382 96Tests
    EUR 521
    Canine TXLNA ELISA Kit
    ECT0382 96Tests
    EUR 521
    Goat TXLNA ELISA Kit
    EGTT0382 96Tests
    EUR 521
    Human TXLNA ELISA Kit
    ELA-E9023h 96 Tests
    EUR 824
    TXLNA ELISA KIT|Human
    EF006468 96 Tests
    EUR 689
    Human TXLNA shRNA Plasmid
    20-abx966233
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse TXLNA shRNA Plasmid
    20-abx980010
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Sheep TXLNA ELISA Kit
    EST0382 96Tests
    EUR 521
    Porcine TXLNA ELISA Kit
    EPT0382 96Tests
    EUR 521
    Rat TXLNA ELISA Kit
    ERT0382 96Tests
    EUR 521
    Monkey TXLNA ELISA Kit
    EMKT0382 96Tests
    EUR 521
    Mouse TXLNA ELISA Kit
    EMT0382 96Tests
    EUR 521
    Recombinant Taxilin Alpha (TXLNa)
    4-RPB182Hu01
    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P40222
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 27.4kDa
    • Isoelectric Point: 7.8
    Description: Recombinant Human Taxilin Alpha expressed in: E.coli
    Recombinant Taxilin Alpha (TXLNa)
    4-RPB182Mu01
    • EUR 485.28
    • EUR 233.00
    • EUR 1544.80
    • EUR 581.60
    • EUR 1063.20
    • EUR 388.00
    • EUR 3712.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q6PAM1
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 57.7kDa
    • Isoelectric Point: 6.3
    Description: Recombinant Mouse Taxilin Alpha expressed in: E.coli
    TXLNA Recombinant Protein (Rat)
    RP235364 100 ug Ask for price
    TXLNA Recombinant Protein (Human)
    RP044575 100 ug Ask for price
    TXLNA Recombinant Protein (Human)
    RP044578 100 ug Ask for price
    TXLNA Recombinant Protein (Mouse)
    RP182360 100 ug Ask for price
    TXLNA Recombinant Protein (Mouse)
    RP182363 100 ug Ask for price
    Human Taxilin Alpha (TXLNa) Protein
    20-abx166674
    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Mouse Taxilin Alpha (TXLNa) Protein
    20-abx168348
    • EUR 676.00
    • EUR 286.00
    • EUR 2082.00
    • EUR 801.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Guinea Pig TXLNA ELISA Kit
    EGT0382 96Tests
    EUR 521
    Txlna ORF Vector (Rat) (pORF)
    ORF078456 1.0 ug DNA
    EUR 506
    TXLNA ORF Vector (Human) (pORF)
    ORF014859 1.0 ug DNA
    EUR 354
    TXLNA ORF Vector (Human) (pORF)
    ORF014860 1.0 ug DNA
    EUR 354
    Txlna ORF Vector (Mouse) (pORF)
    ORF060788 1.0 ug DNA
    EUR 506
    Txlna ORF Vector (Mouse) (pORF)
    ORF060789 1.0 ug DNA
    EUR 506
    TXLNA ELISA Kit (Human) (OKCD07192)
    OKCD07192 96 Wells
    EUR 936
    Description: Description of target: TXLNA may be involved in intracellular vesicle traffic and potentially in calcium-dependent exocytosis in neuroendocrine cells.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL
    TXLNA ELISA Kit (Mouse) (OKCD07193)
    OKCD07193 96 Wells
    EUR 1001
    Description: Description of target: May be involved in intracellular vesicle traffic and potentially in calcium-dependent exocytosis in neuroendocrine cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 5.6pg/mL
    TXLNA ELISA Kit (Mouse) (OKEI00566)
    OKEI00566 96 Wells
    EUR 767
    Description: Description of target: ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.188 ng/mL
    TXLNA ELISA Kit (Rat) (OKEI00851)
    OKEI00851 96 Wells
    EUR 767
    Description: Description of target: ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.094 ng/mL
    TXLNA ELISA Kit (Human) (OKEH01894)
    OKEH01894 96 Wells
    EUR 727
    Description: Description of target: ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.065 ng/mL
    TXLNA ELISA Kit (Mouse) (OKEH03566)
    OKEH03566 96 Wells
    EUR 727
    Description: Description of target: May be involved in intracellular vesicle traffic and potentially in calcium-dependent exocytosis in neuroendocrine cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.081 ng/mL
    Human Alpha-taxilin(TXLNA) ELISA kit
    E01A2018-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Alpha-taxilin(TXLNA) ELISA kit
    E01A2018-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Alpha-taxilin(TXLNA) ELISA kit
    E01A2018-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Human Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Alpha-taxilin(TXLNA) ELISA kit
    E03A2018-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Alpha-taxilin(TXLNA) ELISA kit
    E03A2018-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Alpha-taxilin(TXLNA) ELISA kit
    E03A2018-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Mouse Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Alpha-taxilin(TXLNA) ELISA kit
    E06A2018-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Alpha-taxilin(TXLNA) ELISA kit
    E06A2018-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Goat Alpha-taxilin(TXLNA) ELISA kit
    E06A2018-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Goat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Alpha-taxilin(TXLNA) ELISA kit
    E02A2018-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Alpha-taxilin(TXLNA) ELISA kit
    E02A2018-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rat Alpha-taxilin(TXLNA) ELISA kit
    E02A2018-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Rat Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Alpha-taxilin(TXLNA) ELISA kit
    E07A2018-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Alpha-taxilin(TXLNA) ELISA kit
    E07A2018-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Pig Alpha-taxilin(TXLNA) ELISA kit
    E07A2018-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Porcine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Human Taxilin alpha (TXLNa) ELISA Kit
    20-abx153234
    • EUR 7112.00
    • EUR 3792.00
    • EUR 879.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Mouse Taxilin Alpha (TXLNa) ELISA Kit
    abx255151-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.
    Human Taxilin Alpha (TXLNa) ELISA Kit
    abx251787-96tests 96 tests
    EUR 754
    • Shipped within 5-12 working days.
    Human TXLNA(Alpha-taxilin) ELISA Kit
    EH2425 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: P40222
    • Alias: TXLNA/IL-14/alpha-taxilin/IL14/interleukin 14/taxilin alpha/TXLN
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml
    Dog Alpha-taxilin(TXLNA) ELISA kit
    E08A2018-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Alpha-taxilin(TXLNA) ELISA kit
    E08A2018-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Dog Alpha-taxilin(TXLNA) ELISA kit
    E08A2018-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Canine Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Alpha-taxilin(TXLNA) ELISA kit
    E09A2018-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Alpha-taxilin(TXLNA) ELISA kit
    E09A2018-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Monkey Alpha-taxilin(TXLNA) ELISA kit
    E09A2018-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A sandwich ELISA for quantitative measurement of Monkey Alpha-taxilin(TXLNA) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Mouse Txlna/ Alpha-taxilin ELISA Kit
    E1545Mo 1 Kit
    EUR 632
    Human TXLNA/ Alpha-taxilin ELISA Kit
    E2611Hu 1 Kit
    EUR 605
    Mouse Alpha- taxilin, Txlna ELISA KIT
    ELI-17051m 96 Tests
    EUR 865
    Pig Taxilin Alpha (TXLNa) ELISA Kit
    abx360898-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Rat Taxilin Alpha (TXLNa) ELISA Kit
    abx353957-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.
    Chicken Taxilin Alpha (TXLNa) ELISA Kit
    abx356265-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Monkey Taxilin Alpha (TXLNa) ELISA Kit
    abx358954-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    Mouse Alpha-taxilin (TXLNA) ELISA Kit
    abx520928-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Mouse Taxilin Alpha (TXLNa) ELISA Kit
    20-abx585187
    • EUR 7378.00
    • EUR 3933.00
    • EUR 911.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.
    Human Alpha-taxilin (TXLNA) ELISA Kit
    abx574971-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.
    Human Taxilin alpha (TXLNa) CLIA Kit
    20-abx492473
    • EUR 7973.00
    • EUR 4246.00
    • EUR 981.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Please enquire.
    Mouse Txlna(Alpha-taxilin) ELISA Kit
    EM0803 96T
    EUR 567.6
    • Detection range: 0.156-10 ng/ml
    • Uniprot ID: Q6PAM1
    • Alias: Txlna/TXLNA/IL-14/alpha-taxilin/IL14/interleukin 14/taxilin alpha/TXLN
    Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Mus ;Sensitivity: 0.094 ng/ml
    Txlna sgRNA CRISPR Lentivector set (Mouse)
    K4762601 3 x 1.0 ug
    EUR 339
    Human Alpha- taxilin, TXLNA ELISA KIT
    ELI-40213h 96 Tests
    EUR 824
    Txlna sgRNA CRISPR Lentivector set (Rat)
    K7494201 3 x 1.0 ug
    EUR 339
    TXLNA sgRNA CRISPR Lentivector set (Human)
    K2563001 3 x 1.0 ug
    EUR 339

    TXLNA Rabbit Polyclonal Antibody