PANK2 Rabbit Polyclonal Antibody
Contact Us Below To Order :
 PANK2 Rabbit pAb |
|
A18502-100ul |
Abclonal |
100 ul |
EUR 308 |
PANK2 Rabbit pAb |
|
A18502-200ul |
Abclonal |
200 ul |
EUR 459 |
PANK2 Rabbit pAb |
|
A18502-20ul |
Abclonal |
20 ul |
EUR 183 |
PANK2 Rabbit pAb |
|
A18502-50ul |
Abclonal |
50 ul |
EUR 223 |
 PANK2 antibody |
|
70R-51108 |
Fitzgerald |
100 ul |
EUR 244 |
|
Description: Purified Polyclonal PANK2 antibody |
 PANK2 Antibody |
|
45374-100ul |
SAB |
100ul |
EUR 252 |
PANK2 Antibody |
|
45374-50ul |
SAB |
50ul |
EUR 187 |
PANK2 antibody |
|
10R-5154 |
Fitzgerald |
100 ul |
EUR 691 |
|
Description: Mouse monoclonal PANK2 antibody |
PANK2 antibody |
|
10R-5155 |
Fitzgerald |
100 ul |
EUR 726 |
|
Description: Mouse monoclonal PANK2 antibody |
PANK2 antibody |
|
70R-19106 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal PANK2 antibody |
PANK2 Antibody |
|
DF8588 |
Affbiotech |
200ul |
EUR 304 |
|
Description: PANK2 Antibody detects endogenous levels of total PANK2. |
PANK2 Antibody |
|
1-CSB-PA874850LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200 |
PANK2 Antibody |
|
1-CSB-PA017422GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
) Polyclonal PANK2 Antibody (N-term) |
|
APR08921G |
Leading Biology |
0.1ml |
EUR 484 |
|
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PANK2 (N-term). This antibody is tested and proven to work in the following applications: |
 PANK2 Conjugated Antibody |
|
C45374 |
SAB |
100ul |
EUR 397 |
 anti- PANK2 antibody |
|
FNab06134 |
FN Test |
100µg |
EUR 505.25 |
- Recommended dilution: WB: 1:500-1:1000
- IP: 1:500-1:1000
- IHC: 1:10-1:100
- IF: 1:10-1:100
- Immunogen: pantothenate kinase 2
- Uniprot ID: Q9BZ23
- Gene ID: 80025
- Research Area: Metabolism
|
|
Description: Antibody raised against PANK2 |
 Anti-PANK2 Antibody |
|
A02776 |
BosterBio |
100ul |
EUR 397 |
|
Description: Rabbit Polyclonal PANK2 Antibody. Validated in WB and tested in Human. |
 Anti-PANK2 antibody |
|
STJ192933 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to PANK2 |
 PANK2 siRNA |
|
20-abx927679 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 PANK2 Antibody, HRP conjugated |
|
1-CSB-PA874850LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 PANK2 Antibody, FITC conjugated |
|
1-CSB-PA874850LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 PANK2 Antibody, Biotin conjugated |
|
1-CSB-PA874850LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 PANK2 Blocking Peptide |
|
20-abx063983 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 PANK2 cloning plasmid |
|
CSB-CL874850HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 405
- Sequence: atggcatctcgtggagatagcaccaaagtggataaactagtacgagatatttatggaggggactatgagaggtttggactgccaggctgggctgtggcttcaagctttggaaacatgatgagcaaggagaagcgagaggctgtcagtaaagaggacctggccagagcgactttgat
- Show more
|
|
Description: A cloning plasmid for the PANK2 gene. |
PANK2 Blocking Peptide |
|
DF8588-BP |
Affbiotech |
1mg |
EUR 195 |
) Anti-PANK2 (2B12) |
|
YF-MA11671 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to PANK2 |
 Antibody) Pantothenate Kinase 2 (PANK2) Antibody |
|
20-abx114323 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody |
|
20-abx008032 |
Abbexa |
-
EUR 300.00
-
EUR 439.00
-
EUR 189.00
|
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody |
|
20-abx217632 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody |
|
20-abx318220 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Pantothenate Kinase 2 (PANK2) Antibody |
|
abx236134-100ug |
Abbexa |
100 ug |
EUR 481 |
- Shipped within 5-12 working days.
|
 Human PANK2 shRNA Plasmid |
|
20-abx962733 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) PANK2 Recombinant Protein (Human) |
|
RP022510 |
ABM |
100 ug |
Ask for price |
) PANK2 Recombinant Protein (Rat) |
|
RP219233 |
ABM |
100 ug |
Ask for price |
) PANK2 Recombinant Protein (Mouse) |
|
RP160031 |
ABM |
100 ug |
Ask for price |
 Antibody (HRP)) Pantothenate Kinase 2 (PANK2) Antibody (HRP) |
|
20-abx315132 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (FITC)) Pantothenate Kinase 2 (PANK2) Antibody (FITC) |
|
20-abx315133 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 Antibody (Biotin)) Pantothenate Kinase 2 (PANK2) Antibody (Biotin) |
|
20-abx315134 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (pORF)) PANK2 ORF Vector (Human) (pORF) |
|
ORF007504 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Pank2 ORF Vector (Rat) (pORF) |
|
ORF073079 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) Pank2 ORF Vector (Mouse) (pORF) |
|
ORF053345 |
ABM |
1.0 ug DNA |
EUR 506 |
) PANK2 sgRNA CRISPR Lentivector set (Human) |
|
K1591501 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pank2 sgRNA CRISPR Lentivector set (Mouse) |
|
K4027701 |
ABM |
3 x 1.0 ug |
EUR 339 |
) Pank2 sgRNA CRISPR Lentivector set (Rat) |
|
K6058401 |
ABM |
3 x 1.0 ug |
EUR 339 |
 ELISA Kit) Human Pantothenate Kinase 2 (PANK2) ELISA Kit |
|
abx382044-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 (Target 1)) PANK2 sgRNA CRISPR Lentivector (Human) (Target 1) |
|
K1591502 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) PANK2 sgRNA CRISPR Lentivector (Human) (Target 2) |
|
K1591503 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) PANK2 sgRNA CRISPR Lentivector (Human) (Target 3) |
|
K1591504 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
|
K4027702 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 2) |
|
K4027703 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
|
K4027704 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 1)) Pank2 sgRNA CRISPR Lentivector (Rat) (Target 1) |
|
K6058402 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 2)) Pank2 sgRNA CRISPR Lentivector (Rat) (Target 2) |
|
K6058403 |
ABM |
1.0 ug DNA |
EUR 154 |
 (Target 3)) Pank2 sgRNA CRISPR Lentivector (Rat) (Target 3) |
|
K6058404 |
ABM |
1.0 ug DNA |
EUR 154 |
 (pPB-C-His)) PANK2 Protein Vector (Human) (pPB-C-His) |
|
PV030013 |
ABM |
500 ng |
EUR 329 |
 (pPB-N-His)) PANK2 Protein Vector (Human) (pPB-N-His) |
|
PV030014 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-HA)) PANK2 Protein Vector (Human) (pPM-C-HA) |
|
PV030015 |
ABM |
500 ng |
EUR 329 |
 (pPM-C-His)) PANK2 Protein Vector (Human) (pPM-C-His) |
|
PV030016 |
ABM |
500 ng |
EUR 329 |
 (pPB-C-His)) PANK2 Protein Vector (Mouse) (pPB-C-His) |
|
PV213378 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PANK2 Protein Vector (Mouse) (pPB-N-His) |
|
PV213379 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PANK2 Protein Vector (Mouse) (pPM-C-HA) |
|
PV213380 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PANK2 Protein Vector (Mouse) (pPM-C-His) |
|
PV213381 |
ABM |
500 ng |
EUR 603 |
 (pPB-C-His)) PANK2 Protein Vector (Rat) (pPB-C-His) |
|
PV292314 |
ABM |
500 ng |
EUR 603 |
 (pPB-N-His)) PANK2 Protein Vector (Rat) (pPB-N-His) |
|
PV292315 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-HA)) PANK2 Protein Vector (Rat) (pPM-C-HA) |
|
PV292316 |
ABM |
500 ng |
EUR 603 |
 (pPM-C-His)) PANK2 Protein Vector (Rat) (pPM-C-His) |
|
PV292317 |
ABM |
500 ng |
EUR 603 |
 Pank2 3'UTR GFP Stable Cell Line |
|
TU165879 |
ABM |
1.0 ml |
Ask for price |
 PANK2 3'UTR Luciferase Stable Cell Line |
|
TU017363 |
ABM |
1.0 ml |
EUR 2333 |
 Pank2 3'UTR Luciferase Stable Cell Line |
|
TU115879 |
ABM |
1.0 ml |
Ask for price |
 PANK2 3'UTR GFP Stable Cell Line |
|
TU067363 |
ABM |
1.0 ml |
EUR 2333 |
Pank2 3'UTR GFP Stable Cell Line |
|
TU265788 |
ABM |
1.0 ml |
Ask for price |
Pank2 3'UTR Luciferase Stable Cell Line |
|
TU215788 |
ABM |
1.0 ml |
Ask for price |
 Human Pantothenate kinase 2, mitochondrial, PANK2 ELISA KIT |
|
ELI-37781h |
Lifescience Market |
96 Tests |
EUR 824 |
 VEGF Rabbit Polyclonal Antibody |
|
ES8453-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
VEGF Rabbit Polyclonal Antibody |
|
ES8453-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 CD10 Rabbit Polyclonal Antibody |
|
ES8454-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
CD10 Rabbit Polyclonal Antibody |
|
ES8454-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 NM23A Rabbit Polyclonal Antibody |
|
ES8455-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
NM23A Rabbit Polyclonal Antibody |
|
ES8455-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 ATM Rabbit Polyclonal Antibody |
|
ES8456-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8456-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
ATM Rabbit Polyclonal Antibody |
|
ES8457-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 HSC70 Rabbit Polyclonal Antibody |
|
ES8558-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSC70 Rabbit Polyclonal Antibody |
|
ES8558-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP40 Rabbit Polyclonal Antibody |
|
ES8559-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
HSP40 Rabbit Polyclonal Antibody |
|
ES8559-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 HSP90? Rabbit Polyclonal Antibody |
|
ES8560-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
HSP90? Rabbit Polyclonal Antibody |
|
ES8560-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 IkB ? Rabbit Polyclonal Antibody |
|
ES8561-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
IkB ? Rabbit Polyclonal Antibody |
|
ES8561-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JAK1 Rabbit Polyclonal Antibody |
|
ES8562-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK1 Rabbit Polyclonal Antibody |
|
ES8562-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JAK2 Rabbit Polyclonal Antibody |
|
ES8563-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JAK2 Rabbit Polyclonal Antibody |
|
ES8563-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 JNK2 Rabbit Polyclonal Antibody |
|
ES8564-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
JNK2 Rabbit Polyclonal Antibody |
|
ES8564-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC |
 JNK3 Rabbit Polyclonal Antibody |
|
ES8565-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
JNK3 Rabbit Polyclonal Antibody |
|
ES8565-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
 MEK2 Rabbit Polyclonal Antibody |
|
ES8566-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
MEK2 Rabbit Polyclonal Antibody |
|
ES8566-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC |
 MEK3 Rabbit Polyclonal Antibody |
|
ES8567-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
MEK3 Rabbit Polyclonal Antibody |
|
ES8567-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC |
PANK2 Rabbit Polyclonal Antibody
ELISA Kit)