Bross Medical GmbH

Biotech lab instruments & accessories

PANK2 Rabbit Polyclonal Antibody

PANK2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PANK2 Rabbit pAb
    A18502-100ul 100 ul
    EUR 308

    PANK2 Rabbit pAb
    A18502-200ul 200 ul
    EUR 459

    PANK2 Rabbit pAb
    A18502-20ul 20 ul
    EUR 183

    PANK2 Rabbit pAb
    A18502-50ul 50 ul
    EUR 223

    PANK2 antibody
    70R-19106 50 ul
    EUR 435
    Description: Rabbit polyclonal PANK2 antibody

    PANK2 antibody
    10R-5154 100 ul
    EUR 691
    Description: Mouse monoclonal PANK2 antibody

    PANK2 antibody
    10R-5155 100 ul
    EUR 726
    Description: Mouse monoclonal PANK2 antibody

    PANK2 Antibody
    45374-100ul 100ul
    EUR 252

    PANK2 Antibody
    45374-50ul 50ul
    EUR 187

    PANK2 Antibody
    1-CSB-PA874850LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

    PANK2 Antibody
    DF8588 200ul
    EUR 304
    Description: PANK2 Antibody detects endogenous levels of total PANK2.

    PANK2 Antibody
    1-CSB-PA017422GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    PANK2 antibody
    70R-51108 100 ul
    EUR 244
    Description: Purified Polyclonal PANK2 antibody

    PANK2 Antibody
    ABD8588 100 ug
    EUR 438

    Polyclonal PANK2 Antibody (N-term)
    APR08921G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PANK2 (N-term). This antibody is tested and proven to work in the following applications:

    Anti-PANK2 Antibody
    A02776 100ul
    EUR 397
    Description: Rabbit Polyclonal PANK2 Antibody. Validated in WB and tested in Human.

    PANK2 Conjugated Antibody
    C45374 100ul
    EUR 397

    anti- PANK2 antibody
    FNab06134 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:1000
    • IP: 1:500-1:1000
    • IHC: 1:10-1:100
    • IF: 1:10-1:100
    • Immunogen: pantothenate kinase 2
    • Uniprot ID: Q9BZ23
    • Gene ID: 80025
    • Research Area: Metabolism
    Description: Antibody raised against PANK2

    Anti-PANK2 antibody
    PAab06134 100 ug
    EUR 355

    Anti-PANK2 antibody
    STJ11100453 100 µl
    EUR 277

    Anti-PANK2 antibody
    STJ192933 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PANK2

    PANK2 siRNA
    20-abx927679
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    pOTB7-PANK2
    PVT12303 2 ug
    EUR 391

    PANK2 Antibody, HRP conjugated
    1-CSB-PA874850LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    PANK2 Antibody, FITC conjugated
    1-CSB-PA874850LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    PANK2 Antibody, Biotin conjugated
    1-CSB-PA874850LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PANK2. Recognizes PANK2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    PANK2 Blocking Peptide
    DF8588-BP 1mg
    EUR 195

    PANK2 Blocking Peptide
    20-abx063983
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    PANK2 cloning plasmid
    CSB-CL874850HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 405
    • Sequence: atggcatctcgtggagatagcaccaaagtggataaactagtacgagatatttatggaggggactatgagaggtttggactgccaggctgggctgtggcttcaagctttggaaacatgatgagcaaggagaagcgagaggctgtcagtaaagaggacctggccagagcgactttgat
    • Show more
    Description: A cloning plasmid for the PANK2 gene.

    Anti-PANK2 (2B12)
    YF-MA11671 100 ug
    EUR 363
    Description: Mouse monoclonal to PANK2

    Pantothenate Kinase 2 (PANK2) Antibody
    20-abx008032
    • EUR 300.00
    • EUR 439.00
    • EUR 189.00
    • 100 ul
    • 200 ul
    • 30 ul
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody
    20-abx217632
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody
    20-abx114323
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody
    abx236134-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Pantothenate Kinase 2 (PANK2) Antibody
    20-abx318220
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    PANK2 ELISA KIT|Human
    EF001546 96 Tests
    EUR 689

    Human PANK2 shRNA Plasmid
    20-abx962733
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PANK2 Recombinant Protein (Human)
    RP022510 100 ug Ask for price

    PANK2 Recombinant Protein (Mouse)
    RP160031 100 ug Ask for price

    PANK2 Recombinant Protein (Rat)
    RP219233 100 ug Ask for price

    Pantothenate Kinase 2 (PANK2) Antibody (HRP)
    20-abx315132
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody (FITC)
    20-abx315133
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Pantothenate Kinase 2 (PANK2) Antibody (Biotin)
    20-abx315134
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Pank2 ORF Vector (Rat) (pORF)
    ORF073079 1.0 ug DNA
    EUR 506

    PANK2 ORF Vector (Human) (pORF)
    ORF007504 1.0 ug DNA
    EUR 95

    Pank2 ORF Vector (Mouse) (pORF)
    ORF053345 1.0 ug DNA
    EUR 506

    pECMV-Pank2-m-FLAG Plasmid
    PVT14904 2 ug
    EUR 325

    Pank2 sgRNA CRISPR Lentivector set (Rat)
    K6058401 3 x 1.0 ug
    EUR 339

    Pank2 sgRNA CRISPR Lentivector set (Mouse)
    K4027701 3 x 1.0 ug
    EUR 339

    PANK2 sgRNA CRISPR Lentivector set (Human)
    K1591501 3 x 1.0 ug
    EUR 339

    Human Pantothenate Kinase 2 (PANK2) ELISA Kit
    abx382044-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Pank2 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6058402 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6058403 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6058404 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4027702 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4027703 1.0 ug DNA
    EUR 154

    Pank2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4027704 1.0 ug DNA
    EUR 154

    PANK2 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1591502 1.0 ug DNA
    EUR 154

    PANK2 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1591503 1.0 ug DNA
    EUR 154

    PANK2 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1591504 1.0 ug DNA
    EUR 154

    PANK2 Protein Vector (Rat) (pPB-C-His)
    PV292314 500 ng
    EUR 603

    PANK2 Protein Vector (Rat) (pPB-N-His)
    PV292315 500 ng
    EUR 603

    PANK2 Protein Vector (Rat) (pPM-C-HA)
    PV292316 500 ng
    EUR 603

    PANK2 Protein Vector (Rat) (pPM-C-His)
    PV292317 500 ng
    EUR 603

    PANK2 Protein Vector (Mouse) (pPB-C-His)
    PV213378 500 ng
    EUR 603

    PANK2 Protein Vector (Mouse) (pPB-N-His)
    PV213379 500 ng
    EUR 603

    PANK2 Protein Vector (Mouse) (pPM-C-HA)
    PV213380 500 ng
    EUR 603

    PANK2 Protein Vector (Mouse) (pPM-C-His)
    PV213381 500 ng
    EUR 603

    PANK2 Protein Vector (Human) (pPB-C-His)
    PV030013 500 ng
    EUR 329

    PANK2 Protein Vector (Human) (pPB-N-His)
    PV030014 500 ng
    EUR 329

    PANK2 Protein Vector (Human) (pPM-C-HA)
    PV030015 500 ng
    EUR 329

    PANK2 Protein Vector (Human) (pPM-C-His)
    PV030016 500 ng
    EUR 329

    Human Pantothenate Kinase 2(PANK2)ELISA Kit
    QY-E03648 96T
    EUR 361

    Pank2 3'UTR Luciferase Stable Cell Line
    TU115879 1.0 ml Ask for price

    Pank2 3'UTR GFP Stable Cell Line
    TU165879 1.0 ml Ask for price

    Pank2 3'UTR Luciferase Stable Cell Line
    TU215788 1.0 ml Ask for price

    Pank2 3'UTR GFP Stable Cell Line
    TU265788 1.0 ml Ask for price

    PANK2 3'UTR GFP Stable Cell Line
    TU067363 1.0 ml
    EUR 2333

    PANK2 3'UTR Luciferase Stable Cell Line
    TU017363 1.0 ml
    EUR 2333

    Human Pantothenate kinase 2, mitochondrial, PANK2 ELISA KIT
    ELI-37781h 96 Tests
    EUR 824

    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252

    PANK2 Rabbit Polyclonal Antibody