PRKRA Rabbit Polyclonal Antibody

PRKRA Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PRKRA Polyclonal Antibody
    ABP60000-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human PRKRA protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PRKRA from Human, Mouse, Rat. This PRKRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRKRA protein
    PRKRA Polyclonal Antibody
    ABP60000-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human PRKRA protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PRKRA from Human, Mouse, Rat. This PRKRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRKRA protein
    PRKRA Polyclonal Antibody
    ABP60000-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human PRKRA protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PRKRA from Human, Mouse, Rat. This PRKRA antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PRKRA protein
    PRKRA Polyclonal Antibody
    A68270 100 µg
    EUR 570.55
    Description: fast delivery possible
    PRKRA Rabbit pAb
    A5417-100ul 100 ul
    EUR 308
    PRKRA Rabbit pAb
    A5417-200ul 200 ul
    EUR 459
    PRKRA Rabbit pAb
    A5417-20ul 20 ul
    EUR 183
    PRKRA Rabbit pAb
    A5417-50ul 50 ul
    EUR 223
    PRKRA antibody
    70R-5896 50 ug
    EUR 467
    Description: Rabbit polyclonal PRKRA antibody raised against the middle region of PRKRA
    PRKRA antibody
    70R-5897 50 ug
    EUR 467
    Description: Rabbit polyclonal PRKRA antibody raised against the N terminal of PRKRA
    PRKRA Antibody
    ABD7334 100 ug
    EUR 438
    PRKRA Antibody
    32843-100ul 100ul
    EUR 252
    PRKRA antibody
    10R-1568 100 ug
    EUR 512
    Description: Mouse monoclonal PRKRA antibody
    PRKRA antibody
    70R-19532 50 ul
    EUR 435
    Description: Rabbit polyclonal PRKRA antibody
    PRKRA Antibody
    DF7334 200ul
    EUR 304
    Description: PRKRA Antibody detects endogenous levels of total PRKRA.
    PRKRA Antibody
    1-CSB-PA13669A0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:50-1:200, IF:1:50-1:500
    PRKRA Antibody
    1-CSB-PA018717GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF
    PRKRA Polyclonal Antibody, Biotin Conjugated
    A68271 100 µg
    EUR 570.55
    Description: reagents widely cited
    PRKRA Polyclonal Antibody, FITC Conjugated
    A68272 100 µg
    EUR 570.55
    Description: Ask the seller for details
    PRKRA Polyclonal Antibody, HRP Conjugated
    A68273 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Prkra/ Rat Prkra ELISA Kit
    ELI-21653r 96 Tests
    EUR 886
    PRKRA Conjugated Antibody
    C32843 100ul
    EUR 397
    PRKRA (pS246) Antibody
    abx032043-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    PRKRA (pS246) Antibody
    abx032043-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    PRKRA Antibody (HRP)
    20-abx306568
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    PRKRA Antibody (FITC)
    20-abx306569
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    PRKRA Antibody (Biotin)
    20-abx306570
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Anti-PRKRA antibody
    STJ27370 100 µl
    EUR 277
    Description: This gene encodes a protein kinase activated by double-stranded RNA which mediates the effects of interferon in response to viral infection. Mutations in this gene have been associated with dystonia. Alternative splicing results in multiple transcript variants.
    Anti-PRKRA antibody
    STJ193032 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PRKRA
    PRKRA siRNA
    20-abx904247
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PRKRA siRNA
    20-abx929793
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PRKRA siRNA
    20-abx929794
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PRKRA Antibody, HRP conjugated
    1-CSB-PA13669B0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    PRKRA Antibody, FITC conjugated
    1-CSB-PA13669C0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    PRKRA Antibody, Biotin conjugated
    1-CSB-PA13669D0Rb
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PRKRA. Recognizes PRKRA from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    PRKRA cloning plasmid
    CSB-CL018717HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 942
    • Sequence: atgtcccagagcaggcaccgcgccgaggccccgccgctggagcgcgaggacagtgggaccttcagtttggggaagatgataacagctaagccagggaaaacaccgattcaggtattacacgaatacggcatgaagaccaagaacatcccagtttatgaatgtgaaagatctgatgt
    • Show more
    Description: A cloning plasmid for the PRKRA gene.
    PRKRA Blocking Peptide
    33R-6483 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRKRA antibody, catalog no. 70R-5897
    PRKRA Blocking Peptide
    33R-8043 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRKRA antibody, catalog no. 70R-5896
    PRKRA Blocking Peptide
    DF7334-BP 1mg
    EUR 195
    Mouse PRKRA shRNA Plasmid
    20-abx973595
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Rat PRKRA shRNA Plasmid
    20-abx989655
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Bovine PRKRA ELISA KIT
    ELI-15441b 96 Tests
    EUR 928
    Mouse Prkra ELISA KIT
    ELI-43081m 96 Tests
    EUR 865
    Human PRKRA ELISA KIT
    ELI-45408h 96 Tests
    EUR 824

    PRKRA Rabbit Polyclonal Antibody