LAT2 Rabbit Polyclonal Antibody

LAT2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    LAT2 Rabbit pAb
    A8675-100ul 100 ul
    EUR 308
    LAT2 Rabbit pAb
    A8675-200ul 200 ul
    EUR 459
    LAT2 Rabbit pAb
    A8675-20ul 20 ul Ask for price
    LAT2 Rabbit pAb
    A8675-50ul 50 ul Ask for price
    WBS15/LAT2 (LAT2) Antibody
    abx239476-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Polyclonal LAT2 Antibody (Center)
    APR17173G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LAT2 (Center). This antibody is tested and proven to work in the following applications:
    LAT2 antibody
    70R-18221 50 ul
    EUR 435
    Description: Rabbit polyclonal LAT2 antibody
    LAT2 Antibody
    35799-100ul 100ul
    EUR 252
    LAT2 Antibody
    1-CSB-PA145350
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against LAT2. Recognizes LAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:10-1:50
    LAT2 Antibody
    1-CSB-PA012768GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against LAT2. Recognizes LAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    Polyclonal LAT2 Antibody (internal region)
    APR17174G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LAT2 (internal region). This antibody is tested and proven to work in the following applications:
    Polyclonal LAT2 / NTAL Antibody (aa91-243)
    APR17172G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LAT2 / NTAL (aa91-243). This antibody is tested and proven to work in the following applications:
    LAT2 Conjugated Antibody
    C35799 100ul
    EUR 397
    Anti-LAT2 antibody
    STJ111376 100 µl
    EUR 277
    Description: This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein.
    Anti-LAT2 Antibody
    STJ501582 100 µg
    EUR 476
    Anti-LAT2 antibody
    STJ193101 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to LAT2
    Anti-LAT2 antibody
    STJ72991 100 µg
    EUR 359
    Lat2/ Rat Lat2 ELISA Kit
    ELI-39768r 96 Tests
    EUR 886
    Human WBS15/LAT2 (LAT2) ELISA Kit
    abx392180-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    LAT2 siRNA
    20-abx902937
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LAT2 siRNA
    20-abx922292
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LAT2 siRNA
    20-abx922293
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti- WBS15/LAT2 antibody
    FNab09476 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:5000,IHC: 1:20-1:200
    • Immunogen: linker for activation of T cells family, member 2
    • Uniprot ID: Q9GZY6
    • Research Area: Immunology, Signal Transduction
    Description: Antibody raised against WBS15/LAT2
    Anti-NTAL/LAT2 Antibody
    PA2039 100ug/vial
    EUR 294
    Anti-WBS15/LAT2 antibody
    PAab09476 100 ug
    EUR 386
    Anti-NTAL/LAT2 Antibody
    PB9239 100ug/vial
    EUR 334
    Anti-LAT2 Antibody (Biotin)
    STJ501583 100 µg
    EUR 586
    Anti-LAT2 Antibody (FITC)
    STJ501584 100 µg
    EUR 586
    LAT2 Blocking Peptide
    20-abx161147
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    LAT2 cloning plasmid
    CSB-CL872419HU-10ug 10ug
    EUR 314
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 732
    • Sequence: atgagctcggggactgaactgctgtggcccggagcagcgctgctggtgctgttgggggtggcagccagtctgtgtgtgcgctgctcacgcccaggtgcaaagaggtcagagaaaatctaccagcagagaagtctgcgtgaggaccaacagagctttacggggtcccggacctactc
    • Show more
    Description: A cloning plasmid for the LAT2 gene.
    Anti-LAT2 (3F10)
    YF-MA17884 100 ug
    EUR 363
    Description: Mouse monoclonal to LAT2
    Chicken LAT2 ELISA KIT
    ELI-21345c 96 Tests
    EUR 928
    Human LAT2 ELISA KIT
    ELI-23799h 96 Tests
    EUR 824
    Rat LAT2 shRNA Plasmid
    20-abx989992
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse LAT2 shRNA Plasmid
    20-abx974890
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human LAT2 shRNA Plasmid
    20-abx955104
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse Lat2 ELISA KIT
    ELI-39767m 96 Tests
    EUR 865
    LAT2 Recombinant Protein (Human)
    RP017569 100 ug Ask for price
    LAT2 Recombinant Protein (Rat)
    RP207851 100 ug Ask for price
    LAT2 Recombinant Protein (Mouse)
    RP146921 100 ug Ask for price
    LAT2 Recombinant Protein (Mouse)
    RP146924 100 ug Ask for price
    WBS15/LAT2 ELISA KIT|Human
    EF004257 96 Tests
    EUR 689
    Lat2 ORF Vector (Rat) (pORF)
    ORF069285 1.0 ug DNA
    EUR 506
    LAT2 ORF Vector (Human) (pORF)
    ORF005857 1.0 ug DNA
    EUR 95
    Lat2 ORF Vector (Mouse) (pORF)
    ORF048975 1.0 ug DNA
    EUR 506
    Lat2 ORF Vector (Mouse) (pORF)
    ORF048976 1.0 ug DNA
    EUR 506
    Monoclonal SLC7A8 / LAT2 Antibody (clone 4H10), Clone: 4H10
    APR10147G 0.05ml
    EUR 484
    Description: A Monoclonal antibody against Human SLC7A8 / LAT2 (clone 4H10). The antibodies are raised in Mouse and are from clone 4H10. This antibody is applicable in IHC-P, IF, IP, Flo
    Lat2 sgRNA CRISPR Lentivector set (Rat)
    K7552501 3 x 1.0 ug
    EUR 339
    Lat2 sgRNA CRISPR Lentivector set (Mouse)
    K3476701 3 x 1.0 ug
    EUR 339
    LAT2 sgRNA CRISPR Lentivector set (Human)
    K1198101 3 x 1.0 ug
    EUR 339
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human)
    4-PAP555Hu01
    • EUR 261.00
    • EUR 2734.00
    • EUR 676.00
    • EUR 330.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2)
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse)
    4-PAP555Mu01
    • EUR 266.00
    • EUR 2813.00
    • EUR 694.00
    • EUR 337.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2)
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat)
    4-PAP555Ra01
    • EUR 275.00
    • EUR 2958.00
    • EUR 727.00
    • EUR 350.00
    • EUR 226.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2)
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), APC
    4-PAP555Hu01-APC
    • EUR 367.00
    • EUR 3581.00
    • EUR 989.00
    • EUR 470.00
    • EUR 228.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), Biotinylated
    4-PAP555Hu01-Biotin
    • EUR 327.00
    • EUR 2684.00
    • EUR 783.00
    • EUR 403.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), Cy3
    4-PAP555Hu01-Cy3
    • EUR 447.00
    • EUR 4733.00
    • EUR 1277.00
    • EUR 585.00
    • EUR 263.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), FITC
    4-PAP555Hu01-FITC
    • EUR 313.00
    • EUR 2884.00
    • EUR 811.00
    • EUR 396.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), HRP
    4-PAP555Hu01-HRP
    • EUR 334.00
    • EUR 3120.00
    • EUR 873.00
    • EUR 424.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), PE
    4-PAP555Hu01-PE
    • EUR 313.00
    • EUR 2884.00
    • EUR 811.00
    • EUR 396.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), APC
    4-PAP555Mu01-APC
    • EUR 374.00
    • EUR 3689.00
    • EUR 1016.00
    • EUR 481.00
    • EUR 232.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), Biotinylated
    4-PAP555Mu01-Biotin
    • EUR 332.00
    • EUR 2763.00
    • EUR 803.00
    • EUR 411.00
    • EUR 228.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), Cy3
    4-PAP555Mu01-Cy3
    • EUR 457.00
    • EUR 4877.00
    • EUR 1313.00
    • EUR 600.00
    • EUR 267.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), FITC
    4-PAP555Mu01-FITC
    • EUR 319.00
    • EUR 2971.00
    • EUR 832.00
    • EUR 405.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), HRP
    4-PAP555Mu01-HRP
    • EUR 341.00
    • EUR 3213.00
    • EUR 897.00
    • EUR 433.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), PE
    4-PAP555Mu01-PE
    • EUR 319.00
    • EUR 2971.00
    • EUR 832.00
    • EUR 405.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), APC
    4-PAP555Ra01-APC
    • EUR 388.00
    • EUR 3887.00
    • EUR 1065.00
    • EUR 501.00
    • EUR 237.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), Biotinylated
    4-PAP555Ra01-Biotin
    • EUR 343.00
    • EUR 2908.00
    • EUR 839.00
    • EUR 425.00
    • EUR 232.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), Cy3
    4-PAP555Ra01-Cy3
    • EUR 476.00
    • EUR 5141.00
    • EUR 1379.00
    • EUR 626.00
    • EUR 275.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), FITC
    4-PAP555Ra01-FITC
    • EUR 330.00
    • EUR 3129.00
    • EUR 872.00
    • EUR 420.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), HRP
    4-PAP555Ra01-HRP
    • EUR 353.00
    • EUR 3385.00
    • EUR 940.00
    • EUR 451.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), PE
    4-PAP555Ra01-PE
    • EUR 330.00
    • EUR 3129.00
    • EUR 872.00
    • EUR 420.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.
    Lat2 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7552502 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7552503 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7552504 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3476702 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3476703 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3476704 1.0 ug DNA
    EUR 154
    LAT2 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1198102 1.0 ug DNA
    EUR 154
    LAT2 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1198103 1.0 ug DNA
    EUR 154
    LAT2 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1198104 1.0 ug DNA
    EUR 154
    LAT2 Protein Vector (Human) (pPB-C-His)
    PV023425 500 ng
    EUR 329
    LAT2 Protein Vector (Human) (pPB-N-His)
    PV023426 500 ng
    EUR 329
    LAT2 Protein Vector (Human) (pPM-C-HA)
    PV023427 500 ng
    EUR 329
    LAT2 Protein Vector (Human) (pPM-C-His)
    PV023428 500 ng
    EUR 329
    LAT2 Protein Vector (Rat) (pPB-C-His)
    PV277138 500 ng
    EUR 603
    LAT2 Protein Vector (Rat) (pPB-N-His)
    PV277139 500 ng
    EUR 603
    LAT2 Protein Vector (Rat) (pPM-C-HA)
    PV277140 500 ng
    EUR 603
    LAT2 Protein Vector (Rat) (pPM-C-His)
    PV277141 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPB-C-His)
    PV195898 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPB-N-His)
    PV195899 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPM-C-HA)
    PV195900 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPM-C-His)
    PV195901 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPB-C-His)
    PV195902 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPB-N-His)
    PV195903 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPM-C-HA)
    PV195904 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPM-C-His)
    PV195905 500 ng
    EUR 603
    Lat2 3'UTR Luciferase Stable Cell Line
    TU110918 1.0 ml Ask for price
    Lat2 3'UTR GFP Stable Cell Line
    TU160918 1.0 ml Ask for price
    Lat2 3'UTR Luciferase Stable Cell Line
    TU206957 1.0 ml Ask for price
    Lat2 3'UTR GFP Stable Cell Line
    TU256957 1.0 ml Ask for price
    LAT2 3'UTR GFP Stable Cell Line
    TU062286 1.0 ml
    EUR 1521
    LAT2 3'UTR Luciferase Stable Cell Line
    TU012286 1.0 ml
    EUR 1521
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), APC-Cy7
    4-PAP555Hu01-APC-Cy7
    • EUR 614.00
    • EUR 7042.00
    • EUR 1858.00
    • EUR 821.00
    • EUR 337.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC-Cy7.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), APC-Cy7
    4-PAP555Mu01-APC-Cy7
    • EUR 628.00
    • EUR 7258.00
    • EUR 1912.00
    • EUR 842.00
    • EUR 344.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC-Cy7.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), APC-Cy7
    4-PAP555Ra01-APC-Cy7
    • EUR 657.00
    • EUR 7654.00
    • EUR 2011.00
    • EUR 882.00
    • EUR 355.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC-Cy7.
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    Rabbit Hemoglobin Polyclonal Antibody
    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Met Rabbit Polyclonal Antibody
    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    VEGF Rabbit Polyclonal Antibody
    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    CD10 Rabbit Polyclonal Antibody
    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    NM23A Rabbit Polyclonal Antibody
    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    ATM Rabbit Polyclonal Antibody
    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    ATM Rabbit Polyclonal Antibody
    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSC70 Rabbit Polyclonal Antibody
    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP40 Rabbit Polyclonal Antibody
    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    HSP90Alpha Rabbit Polyclonal Antibody
    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK1 Rabbit Polyclonal Antibody
    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JAK2 Rabbit Polyclonal Antibody
    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK2 Rabbit Polyclonal Antibody
    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    JNK3 Rabbit Polyclonal Antibody
    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK2 Rabbit Polyclonal Antibody
    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    MEK3 Rabbit Polyclonal Antibody
    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    Nrf2 Rabbit Polyclonal Antibody
    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a
    ATG4a Rabbit Polyclonal Antibody
    ABP57576-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    LAT2 Rabbit Polyclonal Antibody