LAT2 Rabbit Polyclonal Antibody

LAT2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

LAT2 Rabbit pAb
A8675-100ul	Abclonal	100 ul	EUR 308

LAT2 Rabbit pAb
A8675-200ul	Abclonal	200 ul	EUR 459

LAT2 Rabbit pAb
A8675-20ul	Abclonal	20 ul	Ask for price

LAT2 Rabbit pAb
A8675-50ul	Abclonal	50 ul	Ask for price

WBS15/LAT2 (LAT2) Antibody
abx239476-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

Polyclonal LAT2 Antibody (Center)
APR17173G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LAT2 (Center). This antibody is tested and proven to work in the following applications:

LAT2 antibody
70R-18221	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal LAT2 antibody

LAT2 Antibody
35799-100ul	SAB	100ul	EUR 252

LAT2 Antibody
1-CSB-PA145350	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LAT2. Recognizes LAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:10-1:50

LAT2 Antibody
1-CSB-PA012768GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against LAT2. Recognizes LAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

Polyclonal LAT2 Antibody (internal region)
APR17174G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LAT2 (internal region). This antibody is tested and proven to work in the following applications:

Polyclonal LAT2 / NTAL Antibody (aa91-243)
APR17172G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LAT2 / NTAL (aa91-243). This antibody is tested and proven to work in the following applications:

LAT2 Conjugated Antibody
C35799	SAB	100ul	EUR 397

Anti-LAT2 antibody
STJ111376	St John's Laboratory	100 µl	EUR 277
Description: This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein.

Anti-LAT2 Antibody
STJ501582	St John's Laboratory	100 µg	EUR 476

Anti-LAT2 antibody
STJ193101	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LAT2

Anti-LAT2 antibody
STJ72991	St John's Laboratory	100 µg	EUR 359

Lat2/ Rat Lat2 ELISA Kit
ELI-39768r	Lifescience Market	96 Tests	EUR 886

Human WBS15/LAT2 (LAT2) ELISA Kit
abx392180-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

LAT2 siRNA
20-abx902937	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LAT2 siRNA
20-abx922292	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LAT2 siRNA
20-abx922293	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti- WBS15/LAT2 antibody
FNab09476	FN Test	100µg	EUR 548.75
Recommended dilution: WB: 1:500-1:5000,IHC: 1:20-1:200 Immunogen: linker for activation of T cells family, member 2 Uniprot ID: Q9GZY6 Research Area: Immunology, Signal Transduction
Description: Antibody raised against WBS15/LAT2

Anti-NTAL/LAT2 Antibody
PA2039	BosterBio	100ug/vial	EUR 294

Anti-WBS15/LAT2 antibody
PAab09476	Lifescience Market	100 ug	EUR 386

Anti-NTAL/LAT2 Antibody
PB9239	BosterBio	100ug/vial	EUR 334

Anti-LAT2 Antibody (Biotin)
STJ501583	St John's Laboratory	100 µg	EUR 586

Anti-LAT2 Antibody (FITC)
STJ501584	St John's Laboratory	100 µg	EUR 586

LAT2 Blocking Peptide
20-abx161147	Abbexa	EUR 272.00 EUR 411.00	1 mg 5 mg
Shipped within 5-10 working days.

LAT2 cloning plasmid
CSB-CL872419HU-10ug	Cusabio	10ug	EUR 314
Formulation: 10 μg plasmid + 200μl Glycerol Length: 732 Sequence: atgagctcggggactgaactgctgtggcccggagcagcgctgctggtgctgttgggggtggcagccagtctgtgtgtgcgctgctcacgcccaggtgcaaagaggtcagagaaaatctaccagcagagaagtctgcgtgaggaccaacagagctttacggggtcccggacctactc Show more
Description: A cloning plasmid for the LAT2 gene.

Anti-LAT2 (3F10)
YF-MA17884	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to LAT2

Chicken LAT2 ELISA KIT
ELI-21345c	Lifescience Market	96 Tests	EUR 928

Human LAT2 ELISA KIT
ELI-23799h	Lifescience Market	96 Tests	EUR 824

Rat LAT2 shRNA Plasmid
20-abx989992	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse LAT2 shRNA Plasmid
20-abx974890	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human LAT2 shRNA Plasmid
20-abx955104	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse Lat2 ELISA KIT
ELI-39767m	Lifescience Market	96 Tests	EUR 865

LAT2 Recombinant Protein (Human)
RP017569	ABM	100 ug	Ask for price

LAT2 Recombinant Protein (Rat)
RP207851	ABM	100 ug	Ask for price

LAT2 Recombinant Protein (Mouse)
RP146921	ABM	100 ug	Ask for price

LAT2 Recombinant Protein (Mouse)
RP146924	ABM	100 ug	Ask for price

WBS15/LAT2 ELISA KIT|Human
EF004257	Lifescience Market	96 Tests	EUR 689

Lat2 ORF Vector (Rat) (pORF)
ORF069285	ABM	1.0 ug DNA	EUR 506

LAT2 ORF Vector (Human) (pORF)
ORF005857	ABM	1.0 ug DNA	EUR 95

Lat2 ORF Vector (Mouse) (pORF)
ORF048975	ABM	1.0 ug DNA	EUR 506

Lat2 ORF Vector (Mouse) (pORF)
ORF048976	ABM	1.0 ug DNA	EUR 506

Monoclonal SLC7A8 / LAT2 Antibody (clone 4H10), Clone: 4H10
APR10147G	Leading Biology	0.05ml	EUR 484
Description: A Monoclonal antibody against Human SLC7A8 / LAT2 (clone 4H10). The antibodies are raised in Mouse and are from clone 4H10. This antibody is applicable in IHC-P, IF, IP, Flo

Lat2 sgRNA CRISPR Lentivector set (Rat)
K7552501	ABM	3 x 1.0 ug	EUR 339

Lat2 sgRNA CRISPR Lentivector set (Mouse)
K3476701	ABM	3 x 1.0 ug	EUR 339

LAT2 sgRNA CRISPR Lentivector set (Human)
K1198101	ABM	3 x 1.0 ug	EUR 339

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human)
4-PAP555Hu01	Cloud-Clone	EUR 261.00 EUR 2734.00 EUR 676.00 EUR 330.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg30~Met209) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2)

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse)
4-PAP555Mu01	Cloud-Clone	EUR 266.00 EUR 2813.00 EUR 694.00 EUR 337.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Cys29~Val193) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2)

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat)
4-PAP555Ra01	Cloud-Clone	EUR 275.00 EUR 2958.00 EUR 727.00 EUR 350.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg32~Asp192) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2)

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), APC
4-PAP555Hu01-APC	Cloud-Clone	EUR 367.00 EUR 3581.00 EUR 989.00 EUR 470.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg30~Met209) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), Biotinylated
4-PAP555Hu01-Biotin	Cloud-Clone	EUR 327.00 EUR 2684.00 EUR 783.00 EUR 403.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg30~Met209) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), Cy3
4-PAP555Hu01-Cy3	Cloud-Clone	EUR 447.00 EUR 4733.00 EUR 1277.00 EUR 585.00 EUR 263.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg30~Met209) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), FITC
4-PAP555Hu01-FITC	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg30~Met209) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), HRP
4-PAP555Hu01-HRP	Cloud-Clone	EUR 334.00 EUR 3120.00 EUR 873.00 EUR 424.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg30~Met209) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), PE
4-PAP555Hu01-PE	Cloud-Clone	EUR 313.00 EUR 2884.00 EUR 811.00 EUR 396.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg30~Met209) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), APC
4-PAP555Mu01-APC	Cloud-Clone	EUR 374.00 EUR 3689.00 EUR 1016.00 EUR 481.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Cys29~Val193) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), Biotinylated
4-PAP555Mu01-Biotin	Cloud-Clone	EUR 332.00 EUR 2763.00 EUR 803.00 EUR 411.00 EUR 228.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Cys29~Val193) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), Cy3
4-PAP555Mu01-Cy3	Cloud-Clone	EUR 457.00 EUR 4877.00 EUR 1313.00 EUR 600.00 EUR 267.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Cys29~Val193) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), FITC
4-PAP555Mu01-FITC	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Cys29~Val193) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), HRP
4-PAP555Mu01-HRP	Cloud-Clone	EUR 341.00 EUR 3213.00 EUR 897.00 EUR 433.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Cys29~Val193) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), PE
4-PAP555Mu01-PE	Cloud-Clone	EUR 319.00 EUR 2971.00 EUR 832.00 EUR 405.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Cys29~Val193) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), APC
4-PAP555Ra01-APC	Cloud-Clone	EUR 388.00 EUR 3887.00 EUR 1065.00 EUR 501.00 EUR 237.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg32~Asp192) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), Biotinylated
4-PAP555Ra01-Biotin	Cloud-Clone	EUR 343.00 EUR 2908.00 EUR 839.00 EUR 425.00 EUR 232.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg32~Asp192) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), Cy3
4-PAP555Ra01-Cy3	Cloud-Clone	EUR 476.00 EUR 5141.00 EUR 1379.00 EUR 626.00 EUR 275.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg32~Asp192) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), FITC
4-PAP555Ra01-FITC	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg32~Asp192) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), HRP
4-PAP555Ra01-HRP	Cloud-Clone	EUR 353.00 EUR 3385.00 EUR 940.00 EUR 451.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg32~Asp192) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.

Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), PE
4-PAP555Ra01-PE	Cloud-Clone	EUR 330.00 EUR 3129.00 EUR 872.00 EUR 420.00 EUR 210.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: LAT2 (Arg32~Asp192) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.

Lat2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7552502	ABM	1.0 ug DNA	EUR 154

Lat2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7552503	ABM	1.0 ug DNA	EUR 154

Lat2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7552504	ABM	1.0 ug DNA	EUR 154

Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3476702	ABM	1.0 ug DNA	EUR 154

Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3476703	ABM	1.0 ug DNA	EUR 154

Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3476704	ABM	1.0 ug DNA	EUR 154

LAT2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1198102	ABM	1.0 ug DNA	EUR 154

LAT2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1198103	ABM	1.0 ug DNA	EUR 154

LAT2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1198104	ABM	1.0 ug DNA	EUR 154

LAT2 Protein Vector (Human) (pPB-C-His)
PV023425	ABM	500 ng	EUR 329

LAT2 Protein Vector (Human) (pPB-N-His)
PV023426	ABM	500 ng	EUR 329

LAT2 Protein Vector (Human) (pPM-C-HA)
PV023427	ABM	500 ng	EUR 329

LAT2 Protein Vector (Human) (pPM-C-His)
PV023428	ABM	500 ng	EUR 329

LAT2 Protein Vector (Rat) (pPB-C-His)
PV277138	ABM	500 ng	EUR 603

LAT2 Protein Vector (Rat) (pPB-N-His)
PV277139	ABM	500 ng	EUR 603

LAT2 Protein Vector (Rat) (pPM-C-HA)
PV277140	ABM	500 ng	EUR 603

LAT2 Protein Vector (Rat) (pPM-C-His)
PV277141	ABM	500 ng	EUR 603

LAT2 Protein Vector (Mouse) (pPB-C-His)
PV195898	ABM	500 ng	EUR 603

LAT2 Protein Vector (Mouse) (pPB-N-His)
PV195899	ABM	500 ng	EUR 603

LAT2 Protein Vector (Mouse) (pPM-C-HA)
PV195900	ABM	500 ng	EUR 603

LAT2 Protein Vector (Mouse) (pPM-C-His)
PV195901	ABM	500 ng	EUR 603

LAT2 Protein Vector (Mouse) (pPB-C-His)
PV195902	ABM	500 ng	EUR 603

LAT2 Protein Vector (Mouse) (pPB-N-His)
PV195903	ABM	500 ng	EUR 603

LAT2 Protein Vector (Mouse) (pPM-C-HA)
PV195904	ABM	500 ng	EUR 603

LAT2 Rabbit Polyclonal Antibody