LAT2 Rabbit Polyclonal Antibody

LAT2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    LAT2 Rabbit pAb
    A8675-100ul 100 ul
    EUR 308
    LAT2 Rabbit pAb
    A8675-200ul 200 ul
    EUR 459
    LAT2 Rabbit pAb
    A8675-20ul 20 ul Ask for price
    LAT2 Rabbit pAb
    A8675-50ul 50 ul Ask for price
    WBS15/LAT2 (LAT2) Antibody
    abx239476-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.
    Polyclonal LAT2 Antibody (Center)
    APR17173G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LAT2 (Center). This antibody is tested and proven to work in the following applications:
    LAT2 antibody
    70R-18221 50 ul
    EUR 435
    Description: Rabbit polyclonal LAT2 antibody
    LAT2 Antibody
    35799-100ul 100ul
    EUR 252
    LAT2 Antibody
    1-CSB-PA145350
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against LAT2. Recognizes LAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:10-1:50
    LAT2 Antibody
    1-CSB-PA012768GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against LAT2. Recognizes LAT2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    Polyclonal LAT2 Antibody (internal region)
    APR17174G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human LAT2 (internal region). This antibody is tested and proven to work in the following applications:
    Polyclonal LAT2 / NTAL Antibody (aa91-243)
    APR17172G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LAT2 / NTAL (aa91-243). This antibody is tested and proven to work in the following applications:
    LAT2 Conjugated Antibody
    C35799 100ul
    EUR 397
    Anti-LAT2 antibody
    STJ111376 100 µl
    EUR 277
    Description: This gene is one of the contiguous genes at 7q11.23 commonly deleted in Williams syndrome, a multisystem developmental disorder. This gene consists of at least 14 exons, and its alternative splicing generates 3 transcript variants, all encoding the same protein.
    Anti-LAT2 Antibody
    STJ501582 100 µg
    EUR 476
    Anti-LAT2 antibody
    STJ193101 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to LAT2
    Anti-LAT2 antibody
    STJ72991 100 µg
    EUR 359
    Lat2/ Rat Lat2 ELISA Kit
    ELI-39768r 96 Tests
    EUR 886
    Human WBS15/LAT2 (LAT2) ELISA Kit
    abx392180-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    LAT2 siRNA
    20-abx902937
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LAT2 siRNA
    20-abx922292
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LAT2 siRNA
    20-abx922293
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    anti- WBS15/LAT2 antibody
    FNab09476 100µg
    EUR 548.75
    • Recommended dilution: WB: 1:500-1:5000,IHC: 1:20-1:200
    • Immunogen: linker for activation of T cells family, member 2
    • Uniprot ID: Q9GZY6
    • Research Area: Immunology, Signal Transduction
    Description: Antibody raised against WBS15/LAT2
    Anti-NTAL/LAT2 Antibody
    PA2039 100ug/vial
    EUR 294
    Anti-WBS15/LAT2 antibody
    PAab09476 100 ug
    EUR 386
    Anti-NTAL/LAT2 Antibody
    PB9239 100ug/vial
    EUR 334
    Anti-LAT2 Antibody (Biotin)
    STJ501583 100 µg
    EUR 586
    Anti-LAT2 Antibody (FITC)
    STJ501584 100 µg
    EUR 586
    LAT2 Blocking Peptide
    20-abx161147
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.
    LAT2 cloning plasmid
    CSB-CL872419HU-10ug 10ug
    EUR 314
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 732
    • Sequence: atgagctcggggactgaactgctgtggcccggagcagcgctgctggtgctgttgggggtggcagccagtctgtgtgtgcgctgctcacgcccaggtgcaaagaggtcagagaaaatctaccagcagagaagtctgcgtgaggaccaacagagctttacggggtcccggacctactc
    • Show more
    Description: A cloning plasmid for the LAT2 gene.
    Anti-LAT2 (3F10)
    YF-MA17884 100 ug
    EUR 363
    Description: Mouse monoclonal to LAT2
    Chicken LAT2 ELISA KIT
    ELI-21345c 96 Tests
    EUR 928
    Human LAT2 ELISA KIT
    ELI-23799h 96 Tests
    EUR 824
    Rat LAT2 shRNA Plasmid
    20-abx989992
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse LAT2 shRNA Plasmid
    20-abx974890
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human LAT2 shRNA Plasmid
    20-abx955104
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse Lat2 ELISA KIT
    ELI-39767m 96 Tests
    EUR 865
    LAT2 Recombinant Protein (Human)
    RP017569 100 ug Ask for price
    LAT2 Recombinant Protein (Rat)
    RP207851 100 ug Ask for price
    LAT2 Recombinant Protein (Mouse)
    RP146921 100 ug Ask for price
    LAT2 Recombinant Protein (Mouse)
    RP146924 100 ug Ask for price
    WBS15/LAT2 ELISA KIT|Human
    EF004257 96 Tests
    EUR 689
    Lat2 ORF Vector (Rat) (pORF)
    ORF069285 1.0 ug DNA
    EUR 506
    LAT2 ORF Vector (Human) (pORF)
    ORF005857 1.0 ug DNA
    EUR 95
    Lat2 ORF Vector (Mouse) (pORF)
    ORF048975 1.0 ug DNA
    EUR 506
    Lat2 ORF Vector (Mouse) (pORF)
    ORF048976 1.0 ug DNA
    EUR 506
    Monoclonal SLC7A8 / LAT2 Antibody (clone 4H10), Clone: 4H10
    APR10147G 0.05ml
    EUR 484
    Description: A Monoclonal antibody against Human SLC7A8 / LAT2 (clone 4H10). The antibodies are raised in Mouse and are from clone 4H10. This antibody is applicable in IHC-P, IF, IP, Flo
    Lat2 sgRNA CRISPR Lentivector set (Rat)
    K7552501 3 x 1.0 ug
    EUR 339
    Lat2 sgRNA CRISPR Lentivector set (Mouse)
    K3476701 3 x 1.0 ug
    EUR 339
    LAT2 sgRNA CRISPR Lentivector set (Human)
    K1198101 3 x 1.0 ug
    EUR 339
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human)
    4-PAP555Hu01
    • EUR 261.00
    • EUR 2734.00
    • EUR 676.00
    • EUR 330.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2)
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse)
    4-PAP555Mu01
    • EUR 266.00
    • EUR 2813.00
    • EUR 694.00
    • EUR 337.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2)
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat)
    4-PAP555Ra01
    • EUR 275.00
    • EUR 2958.00
    • EUR 727.00
    • EUR 350.00
    • EUR 226.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2)
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), APC
    4-PAP555Hu01-APC
    • EUR 367.00
    • EUR 3581.00
    • EUR 989.00
    • EUR 470.00
    • EUR 228.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), Biotinylated
    4-PAP555Hu01-Biotin
    • EUR 327.00
    • EUR 2684.00
    • EUR 783.00
    • EUR 403.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), Cy3
    4-PAP555Hu01-Cy3
    • EUR 447.00
    • EUR 4733.00
    • EUR 1277.00
    • EUR 585.00
    • EUR 263.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), FITC
    4-PAP555Hu01-FITC
    • EUR 313.00
    • EUR 2884.00
    • EUR 811.00
    • EUR 396.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), HRP
    4-PAP555Hu01-HRP
    • EUR 334.00
    • EUR 3120.00
    • EUR 873.00
    • EUR 424.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Human), PE
    4-PAP555Hu01-PE
    • EUR 313.00
    • EUR 2884.00
    • EUR 811.00
    • EUR 396.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg30~Met209)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), APC
    4-PAP555Mu01-APC
    • EUR 374.00
    • EUR 3689.00
    • EUR 1016.00
    • EUR 481.00
    • EUR 232.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), Biotinylated
    4-PAP555Mu01-Biotin
    • EUR 332.00
    • EUR 2763.00
    • EUR 803.00
    • EUR 411.00
    • EUR 228.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), Cy3
    4-PAP555Mu01-Cy3
    • EUR 457.00
    • EUR 4877.00
    • EUR 1313.00
    • EUR 600.00
    • EUR 267.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), FITC
    4-PAP555Mu01-FITC
    • EUR 319.00
    • EUR 2971.00
    • EUR 832.00
    • EUR 405.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), HRP
    4-PAP555Mu01-HRP
    • EUR 341.00
    • EUR 3213.00
    • EUR 897.00
    • EUR 433.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Mouse), PE
    4-PAP555Mu01-PE
    • EUR 319.00
    • EUR 2971.00
    • EUR 832.00
    • EUR 405.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Cys29~Val193)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), APC
    4-PAP555Ra01-APC
    • EUR 388.00
    • EUR 3887.00
    • EUR 1065.00
    • EUR 501.00
    • EUR 237.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with APC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), Biotinylated
    4-PAP555Ra01-Biotin
    • EUR 343.00
    • EUR 2908.00
    • EUR 839.00
    • EUR 425.00
    • EUR 232.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Biotin.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), Cy3
    4-PAP555Ra01-Cy3
    • EUR 476.00
    • EUR 5141.00
    • EUR 1379.00
    • EUR 626.00
    • EUR 275.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with Cy3.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), FITC
    4-PAP555Ra01-FITC
    • EUR 330.00
    • EUR 3129.00
    • EUR 872.00
    • EUR 420.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with FITC.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), HRP
    4-PAP555Ra01-HRP
    • EUR 353.00
    • EUR 3385.00
    • EUR 940.00
    • EUR 451.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with HRP.
    Linker For Activation Of T-Cells Family, Member 2 (LAT2) Polyclonal Antibody (Rat), PE
    4-PAP555Ra01-PE
    • EUR 330.00
    • EUR 3129.00
    • EUR 872.00
    • EUR 420.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: LAT2 (Arg32~Asp192)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Linker For Activation Of T-Cells Family, Member 2 (LAT2). This antibody is labeled with PE.
    Lat2 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7552502 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7552503 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7552504 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3476702 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3476703 1.0 ug DNA
    EUR 154
    Lat2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3476704 1.0 ug DNA
    EUR 154
    LAT2 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1198102 1.0 ug DNA
    EUR 154
    LAT2 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1198103 1.0 ug DNA
    EUR 154
    LAT2 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1198104 1.0 ug DNA
    EUR 154
    LAT2 Protein Vector (Human) (pPB-C-His)
    PV023425 500 ng
    EUR 329
    LAT2 Protein Vector (Human) (pPB-N-His)
    PV023426 500 ng
    EUR 329
    LAT2 Protein Vector (Human) (pPM-C-HA)
    PV023427 500 ng
    EUR 329
    LAT2 Protein Vector (Human) (pPM-C-His)
    PV023428 500 ng
    EUR 329
    LAT2 Protein Vector (Rat) (pPB-C-His)
    PV277138 500 ng
    EUR 603
    LAT2 Protein Vector (Rat) (pPB-N-His)
    PV277139 500 ng
    EUR 603
    LAT2 Protein Vector (Rat) (pPM-C-HA)
    PV277140 500 ng
    EUR 603
    LAT2 Protein Vector (Rat) (pPM-C-His)
    PV277141 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPB-C-His)
    PV195898 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPB-N-His)
    PV195899 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPM-C-HA)
    PV195900 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPM-C-His)
    PV195901 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPB-C-His)
    PV195902 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPB-N-His)
    PV195903 500 ng
    EUR 603
    LAT2 Protein Vector (Mouse) (pPM-C-HA)
    PV195904 500 ng
    EUR 603

    LAT2 Rabbit Polyclonal Antibody