RBP1 Rabbit Polyclonal Antibody

RBP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RBP1 Polyclonal Antibody
    ES11888-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against RBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    RBP1 Polyclonal Antibody
    ES11888-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against RBP1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA
    RBP1 Rabbit pAb
    A10029-100ul 100 ul
    EUR 308
    RBP1 Rabbit pAb
    A10029-200ul 200 ul
    EUR 459
    RBP1 Rabbit pAb
    A10029-20ul 20 ul
    EUR 183
    RBP1 Rabbit pAb
    A10029-50ul 50 ul
    EUR 223
    RBP1 Polyclonal Conjugated Antibody
    C27262 100ul
    EUR 397
    Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
    DLR-RBP1-Hu-48T 48T
    EUR 479
    • Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
    DLR-RBP1-Hu-96T 96T
    EUR 621
    • Should the Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Retinol Binding Protein 1, Cellular (RBP1) in samples from serum, plasma, tissue homogenates or other biological fluids.
    Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
    RDR-RBP1-Hu-48Tests 48 Tests
    EUR 500
    Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
    RDR-RBP1-Hu-96Tests 96 Tests
    EUR 692
    Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
    RD-RBP1-Hu-48Tests 48 Tests
    EUR 478
    Human Retinol Binding Protein 1, Cellular (RBP1) ELISA Kit
    RD-RBP1-Hu-96Tests 96 Tests
    EUR 662
    Polyclonal Goat Anti-RBP1 Antibody
    APG00276G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-RBP1 . This antibody is tested and proven to work in the following applications:
    RBP1 antibody
    70R-12616 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal RBP1 antibody
    RBP1 antibody
    70R-12617 100 ul
    EUR 457
    Description: Affinity purified Rabbit polyclonal RBP1 antibody
    RBP1 antibody
    70R-1274 100 ug
    EUR 377
    Description: Rabbit polyclonal RBP1 antibody raised against the middle region of RBP1
    RBP1 antibody
    10R-5603 100 ul
    EUR 726
    Description: Mouse monoclonal RBP1 antibody
    RBP1 antibody
    10R-5604 100 ul
    EUR 691
    Description: Mouse monoclonal RBP1 antibody
    RBP1 Antibody
    1-CSB-PA019480GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen affinity purification
    Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC
    RBP1 Antibody
    1-CSB-PA019480YA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200
    Polyclonal RBP1 / CRBP Antibody (C-Terminus)
    APG01059G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human RBP1 / CRBP (C-Terminus). This antibody is tested and proven to work in the following applications:
    anti- RBP1 antibody
    FNab07188 100µg
    EUR 585
    • Immunogen: retinol binding protein 1, cellular
    • Uniprot ID: P09455
    • Gene ID: 5947
    • Research Area: Signal Transduction, Metabolism, Developmental biology
    Description: Antibody raised against RBP1
    Anti-RBP1 antibody
    PAab07188 100 ug
    EUR 412
    Anti-RBP1 antibody
    STJ112069 100 µl
    EUR 277
    Description: This gene encodes the carrier protein involved in the transport of retinol (vitamin A alcohol) from the liver storage site to peripheral tissue. Vitamin A is a fat-soluble vitamin necessary for growth, reproduction, differentiation of epithelial tissues, and vision. Multiple transcript variants encoding different isoforms have been found for this gene.
    Anti-RBP1 antibody
    STJ193046 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RBP1
    Anti-RBP1 antibody
    STJ70670 100 µg
    EUR 359
    Rbp1/ Rat Rbp1 ELISA Kit
    ELI-04007r 96 Tests
    EUR 886
    RBP1 siRNA
    20-abx904510
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RBP1 siRNA
    20-abx931119
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RBP1 siRNA
    20-abx931120
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RBP1 Antibody, HRP conjugated
    1-CSB-PA019480YB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    RBP1 Antibody, FITC conjugated
    1-CSB-PA019480YC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    RBP1 Antibody, Biotin conjugated
    1-CSB-PA019480YD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBP1. Recognizes RBP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    RBP1 Blocking Peptide
    33R-4007 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBP1 antibody, catalog no. 70R-1274
    RBP1 cloning plasmid
    CSB-CL019480HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 408
    • Sequence: ATGCCAGTCGACTTCACTGGGTACTGGAAGATGTTGGTCAACGAGAATTTCGAGGAGTACCTGCGCGCCCTCGACGTCAATGTGGCCTTGCGCAAAATCGCCAACTTGCTGAAGCCAGACAAAGAGATCGTGCAGGACGGTGACCATATGATCATCCGCACGCTGAGCACTTTTAG
    • Show more
    Description: A cloning plasmid for the RBP1 gene.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine)
    4-PAA400Bo01
    • EUR 259.00
    • EUR 2694.00
    • EUR 667.00
    • EUR 326.00
    • EUR 218.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Met1~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1)
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse)
    4-PAA400Mu01
    • EUR 236.00
    • EUR 2338.00
    • EUR 586.00
    • EUR 294.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1)
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig)
    4-PAA400Po01
    • EUR 259.00
    • EUR 2694.00
    • EUR 667.00
    • EUR 326.00
    • EUR 218.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1)
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat)
    4-PAA400Ra01
    • EUR 243.00
    • EUR 2457.00
    • EUR 613.00
    • EUR 305.00
    • EUR 212.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1)
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), APC
    4-PAA400Bo01-APC
    • EUR 363.00
    • EUR 3527.00
    • EUR 975.00
    • EUR 465.00
    • EUR 226.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Met1~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Biotinylated
    4-PAA400Bo01-Biotin
    • EUR 324.00
    • EUR 2644.00
    • EUR 773.00
    • EUR 399.00
    • EUR 224.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Met1~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), Cy3
    4-PAA400Bo01-Cy3
    • EUR 443.00
    • EUR 4661.00
    • EUR 1259.00
    • EUR 578.00
    • EUR 260.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Met1~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), FITC
    4-PAA400Bo01-FITC
    • EUR 310.00
    • EUR 2841.00
    • EUR 800.00
    • EUR 392.00
    • EUR 201.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Met1~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), HRP
    4-PAA400Bo01-HRP
    • EUR 331.00
    • EUR 3073.00
    • EUR 862.00
    • EUR 419.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Met1~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Bovine), PE
    4-PAA400Bo01-PE
    • EUR 310.00
    • EUR 2841.00
    • EUR 800.00
    • EUR 392.00
    • EUR 201.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Met1~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Bovine Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), APC
    4-PAA400Mu01-APC
    • EUR 329.00
    • EUR 3041.00
    • EUR 854.00
    • EUR 416.00
    • EUR 212.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Biotinylated
    4-PAA400Mu01-Biotin
    • EUR 299.00
    • EUR 2288.00
    • EUR 684.00
    • EUR 363.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), Cy3
    4-PAA400Mu01-Cy3
    • EUR 397.00
    • EUR 4013.00
    • EUR 1097.00
    • EUR 513.00
    • EUR 241.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), FITC
    4-PAA400Mu01-FITC
    • EUR 283.00
    • EUR 2452.00
    • EUR 703.00
    • EUR 353.00
    • EUR 189.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), HRP
    4-PAA400Mu01-HRP
    • EUR 302.00
    • EUR 2652.00
    • EUR 756.00
    • EUR 377.00
    • EUR 200.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Mouse), PE
    4-PAA400Mu01-PE
    • EUR 283.00
    • EUR 2452.00
    • EUR 703.00
    • EUR 353.00
    • EUR 189.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), APC
    4-PAA400Po01-APC
    • EUR 363.00
    • EUR 3527.00
    • EUR 975.00
    • EUR 465.00
    • EUR 226.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Biotinylated
    4-PAA400Po01-Biotin
    • EUR 324.00
    • EUR 2644.00
    • EUR 773.00
    • EUR 399.00
    • EUR 224.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), Cy3
    4-PAA400Po01-Cy3
    • EUR 443.00
    • EUR 4661.00
    • EUR 1259.00
    • EUR 578.00
    • EUR 260.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), FITC
    4-PAA400Po01-FITC
    • EUR 310.00
    • EUR 2841.00
    • EUR 800.00
    • EUR 392.00
    • EUR 201.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), HRP
    4-PAA400Po01-HRP
    • EUR 331.00
    • EUR 3073.00
    • EUR 862.00
    • EUR 419.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Pig), PE
    4-PAA400Po01-PE
    • EUR 310.00
    • EUR 2841.00
    • EUR 800.00
    • EUR 392.00
    • EUR 201.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~Asn135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Pig Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), APC
    4-PAA400Ra01-APC
    • EUR 340.00
    • EUR 3203.00
    • EUR 894.00
    • EUR 432.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with APC.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Biotinylated
    4-PAA400Ra01-Biotin
    • EUR 307.00
    • EUR 2407.00
    • EUR 714.00
    • EUR 375.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Biotin.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), Cy3
    4-PAA400Ra01-Cy3
    • EUR 411.00
    • EUR 4229.00
    • EUR 1151.00
    • EUR 535.00
    • EUR 248.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with Cy3.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), FITC
    4-PAA400Ra01-FITC
    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with FITC.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), HRP
    4-PAA400Ra01-HRP
    • EUR 311.00
    • EUR 2792.00
    • EUR 791.00
    • EUR 391.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with HRP.
    Retinol Binding Protein 1, Cellular (RBP1) Polyclonal Antibody (Rat), PE
    4-PAA400Ra01-PE
    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RBP1 (Pro2~His135)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Retinol Binding Protein 1, Cellular (RBP1). This antibody is labeled with PE.
    Retinol-Binding Protein 1 (Rbp1) Antibody
    20-abx116773
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Retinol-Binding Protein 1 (RBP1) Antibody
    20-abx135947
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Retinol-Binding Protein 1 (RBP1) Antibody
    abx237188-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.
    Retinol-Binding Protein 1 (RBP1) Antibody
    abx433219-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    RBP1 protein (His tag)
    80R-2045 50 ug
    EUR 322
    Description: Recombinant human RBP1 protein (His tag)
    Human RBP1 ELISA Kit
    ELA-E1209h 96 Tests
    EUR 824
    RBP1 ELISA KIT|Human
    EF004456 96 Tests
    EUR 689
    Mouse RBP1 shRNA Plasmid
    20-abx972405
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    RBP1 Rabbit Polyclonal Antibody