DERL1 Rabbit Polyclonal Antibody

DERL1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DERL1 Polyclonal Antibody

    ABP58353-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human DERL1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of DERL1 from Human, Mouse. This DERL1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL1 protein

    DERL1 Polyclonal Antibody

    ES11967-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against DERL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DERL1 Polyclonal Antibody

    ES11967-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against DERL1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DERL1 Rabbit pAb

    A8508-100ul 100 ul
    EUR 308

    DERL1 Rabbit pAb

    A8508-200ul 200 ul
    EUR 459

    DERL1 Rabbit pAb

    A8508-20ul 20 ul
    EUR 183

    DERL1 Rabbit pAb

    A8508-50ul 50 ul
    EUR 223

    DERL1 Polyclonal Conjugated Antibody

    C31579 100ul
    EUR 397

    Polyclonal DERL1 Antibody (C-term)

    APR15722G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DERL1 (C-term). This antibody is tested and proven to work in the following applications:

    Anti-DERL1 antibody

    STJ110806 100 µl
    EUR 277
    Description: The protein encoded by this gene is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This protein recognizes substrate in the ER and works in a complex to retrotranslocate it across the ER membrane into the cytosol. This protein may select cystic fibrosis transmembrane conductance regulator protein (CFTR) for degradation as well as unfolded proteins in Alzheimer's disease. Alternative splicing results in multiple transcript variants that encode different protein isoforms.

    Anti-DERL1 antibody

    STJ193125 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DERL1

    DERL1 siRNA

    20-abx914020
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DERL1 siRNA

    20-abx914021
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    pOTB7-DERL1

    PVT19105 2 ug
    EUR 231

    Derlin-1 (DERL1) Antibody

    20-abx005939
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    DERL1 cloning plasmid

    CSB-CL887128HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 756
    • Sequence: atgtcggacatcggagactggttcaggagcatcccggcgatcacgcgctattggttcgccgccaccgtcgccgtgcccttggtcggcaaactcggcctcatcagcccggcctacctcttcctctggcccgaagccttcctttatcgctttcagatttggaggccaatcactgccac
    • Show more
    Description: A cloning plasmid for the DERL1 gene.

    Anti-DERL1 (1B9)

    YF-MA19309 100 ug
    EUR 363
    Description: Mouse monoclonal to DERL1

    Mouse DERL1 shRNA Plasmid

    20-abx976335
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human DERL1 shRNA Plasmid

    20-abx962321
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    DERL1 Recombinant Protein (Human)

    RP009166 100 ug Ask for price

    DERL1 Recombinant Protein (Rat)

    RP197894 100 ug Ask for price

    DERL1 Recombinant Protein (Mouse)

    RP128804 100 ug Ask for price

    Derl1 ORF Vector (Rat) (pORF)

    ORF065966 1.0 ug DNA
    EUR 506

    DERL1 ORF Vector (Human) (pORF)

    ORF003056 1.0 ug DNA
    EUR 95

    Derl1 ORF Vector (Mouse) (pORF)

    ORF042936 1.0 ug DNA
    EUR 506

    Bovine Derlin- 1, DERL1 ELISA KIT

    ELI-28118b 96 Tests
    EUR 928

    Human Derlin- 1, DERL1 ELISA KIT

    ELI-46940h 96 Tests
    EUR 824

    Mouse Derlin- 1, Derl1 ELISA KIT

    ELI-47007m 96 Tests
    EUR 865

    DERL1 sgRNA CRISPR Lentivector set (Human)

    K0585201 3 x 1.0 ug
    EUR 339

    Derl1 sgRNA CRISPR Lentivector set (Mouse)

    K4819901 3 x 1.0 ug
    EUR 339

    Derl1 sgRNA CRISPR Lentivector set (Rat)

    K6438401 3 x 1.0 ug
    EUR 339

    Human Derlin 1(DERL1)ELISA Kit

    QY-E04984 96T
    EUR 361

    DERL1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0585202 1.0 ug DNA
    EUR 154

    DERL1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0585203 1.0 ug DNA
    EUR 154

    DERL1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0585204 1.0 ug DNA
    EUR 154

    Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4819902 1.0 ug DNA
    EUR 154

    Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4819903 1.0 ug DNA
    EUR 154

    Derl1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4819904 1.0 ug DNA
    EUR 154

    Derl1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6438402 1.0 ug DNA
    EUR 154

    Derl1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6438403 1.0 ug DNA
    EUR 154

    Derl1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6438404 1.0 ug DNA
    EUR 154

    ELISA kit for Bovine Derlin-1 (DERL1)

    KTE10362-48T 48T
    EUR 354
    • Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Bovine Derlin-1 (DERL1)

    KTE10362-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Bovine Derlin-1 (DERL1)

    KTE10362-96T 96T
    EUR 572
    • Derlin-1 (DERL1) is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradation. This pro
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Derlin-1 (DERL1)

    KTE71309-48T 48T
    EUR 332
    • The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Derlin-1 (DERL1)

    KTE71309-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    ELISA kit for Mouse Derlin-1 (DERL1)

    KTE71309-96T 96T
    EUR 539
    • The protein encoded by DERL1 is a member of the derlin family. Members of this family participate in the ER-associated degradation response and retrotranslocate misfolded or unfolded proteins from the ER lumen to the cytosol for proteasomal degradati
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-1 (DERL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

    DERL1 Protein Vector (Mouse) (pPB-C-His)

    PV171742 500 ng
    EUR 603

    DERL1 Protein Vector (Mouse) (pPB-N-His)

    PV171743 500 ng
    EUR 603

    DERL1 Protein Vector (Mouse) (pPM-C-HA)

    PV171744 500 ng
    EUR 603

    DERL1 Protein Vector (Mouse) (pPM-C-His)

    PV171745 500 ng
    EUR 603

    DERL1 Protein Vector (Rat) (pPB-C-His)

    PV263862 500 ng
    EUR 603

    DERL1 Protein Vector (Rat) (pPB-N-His)

    PV263863 500 ng
    EUR 603

    DERL1 Protein Vector (Rat) (pPM-C-HA)

    PV263864 500 ng
    EUR 603

    DERL1 Protein Vector (Rat) (pPM-C-His)

    PV263865 500 ng
    EUR 603

    DERL1 Protein Vector (Human) (pPB-C-His)

    PV012221 500 ng
    EUR 329

    DERL1 Protein Vector (Human) (pPB-N-His)

    PV012222 500 ng
    EUR 329

    DERL1 Protein Vector (Human) (pPM-C-HA)

    PV012223 500 ng
    EUR 329

    DERL1 Protein Vector (Human) (pPM-C-His)

    PV012224 500 ng
    EUR 329

    Derl1 3'UTR GFP Stable Cell Line

    TU155080 1.0 ml Ask for price

    Derl1 3'UTR Luciferase Stable Cell Line

    TU105080 1.0 ml Ask for price

    Derl1 3'UTR Luciferase Stable Cell Line

    TU203353 1.0 ml Ask for price

    Derl1 3'UTR GFP Stable Cell Line

    TU253353 1.0 ml Ask for price

    DERL1 3'UTR GFP Stable Cell Line

    TU055832 1.0 ml
    EUR 4617

    DERL1 3'UTR Luciferase Stable Cell Line

    TU005832 1.0 ml
    EUR 4617

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    DERL1 Rabbit Polyclonal Antibody