OXGR1 Rabbit Polyclonal Antibody

OXGR1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    OXGR1 Polyclonal Antibody

    ABP59780-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210
    • Applications tips:
    Description: A polyclonal antibody for detection of OXGR1 from Human, Mouse, Rat. This OXGR1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OXGR1 protein at amino acid sequence of 130-210

    OXGR1 Polyclonal Antibody

    ES11482-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against OXGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    OXGR1 Polyclonal Antibody

    ES11482-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against OXGR1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    OXGR1 Rabbit pAb

    A15431-100ul 100 ul
    EUR 308

    OXGR1 Rabbit pAb

    A15431-200ul 200 ul
    EUR 459

    OXGR1 Rabbit pAb

    A15431-20ul 20 ul
    EUR 183

    OXGR1 Rabbit pAb

    A15431-50ul 50 ul
    EUR 223

    OXGR1 Polyclonal Conjugated Antibody

    C28963 100ul
    EUR 397

    Polyclonal OXGR1 Antibody (C-term)

    AMM08661G 0.1ml
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OXGR1 (C-term). This antibody is tested and proven to work in the following applications:

    Oxgr1/ Rat Oxgr1 ELISA Kit

    ELI-21812r 96 Tests
    EUR 886

    Anti-OXGR1 antibody

    STJ117626 100 µl
    EUR 277

    Anti-OXGR1 antibody

    STJ192640 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to OXGR1

    OXGR1 siRNA

    20-abx903793
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    OXGR1 siRNA

    20-abx927508
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    OXGR1 siRNA

    20-abx927509
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Polyclonal GPR80 / GPR99 / OXGR1 Antibody (Extracellular Domain)

    APR16608G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR80 / GPR99 / OXGR1 Antibody (Extracellular Domain)

    APR16609G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR80 / GPR99 / OXGR1 Antibody (N-Terminus)

    APR16610G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR80 / GPR99 / OXGR1 (N-Terminus). This antibody is tested and proven to work in the following applications:

    OXGR1 cloning plasmid

    CSB-CL839388HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1014
    • Sequence: ATGAATGAGCCACTAGACTATTTAGCAAATGCTTCTGATTTCCCCGATTATGCAGCTGCTTTTGGAAATTGCACTGATGAAAACATCCCACTCAAGATGCACTACCTCCCTGTTATTTATGGCATTATCTTCCTCGTGGGATTTCCAGGCAATGCAGTAGTGATATCCACTTACA
    • Show more
    Description: A cloning plasmid for the OXGR1 gene.

    OXGR1 ELISA KIT|Human

    EF005390 96 Tests
    EUR 689

    Rat OXGR1 shRNA Plasmid

    20-abx988436
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human OXGR1 shRNA Plasmid

    20-abx959020
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse OXGR1 shRNA Plasmid

    20-abx982379
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    OXGR1 Recombinant Protein (Human)

    RP041977 100 ug Ask for price

    OXGR1 Recombinant Protein (Mouse)

    RP159710 100 ug Ask for price

    OXGR1 Recombinant Protein (Rat)

    RP219014 100 ug Ask for price

    2-Oxoglutarate Receptor 1 (OXGR1) Antibody

    abx034658-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    2-Oxoglutarate Receptor 1 (OXGR1) Antibody

    abx034658-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Oxgr1 ORF Vector (Rat) (pORF)

    ORF073006 1.0 ug DNA
    EUR 506

    OXGR1 ORF Vector (Human) (pORF)

    ORF013993 1.0 ug DNA
    EUR 95

    Oxgr1 ORF Vector (Mouse) (pORF)

    ORF053238 1.0 ug DNA
    EUR 506

    Oxgr1 sgRNA CRISPR Lentivector set (Rat)

    K7423301 3 x 1.0 ug
    EUR 339

    Oxgr1 sgRNA CRISPR Lentivector set (Mouse)

    K3570401 3 x 1.0 ug
    EUR 339

    OXGR1 sgRNA CRISPR Lentivector set (Human)

    K1580401 3 x 1.0 ug
    EUR 339

    Oxgr1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7423302 1.0 ug DNA
    EUR 154

    Oxgr1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7423303 1.0 ug DNA
    EUR 154

    Oxgr1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7423304 1.0 ug DNA
    EUR 154

    Oxgr1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3570402 1.0 ug DNA
    EUR 154

    Oxgr1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3570403 1.0 ug DNA
    EUR 154

    Oxgr1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3570404 1.0 ug DNA
    EUR 154

    OXGR1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1580402 1.0 ug DNA
    EUR 154

    OXGR1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1580403 1.0 ug DNA
    EUR 154

    OXGR1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1580404 1.0 ug DNA
    EUR 154

    OXGR1 Protein Vector (Rat) (pPB-C-His)

    PV292022 500 ng
    EUR 603

    OXGR1 Protein Vector (Rat) (pPB-N-His)

    PV292023 500 ng
    EUR 603

    OXGR1 Protein Vector (Rat) (pPM-C-HA)

    PV292024 500 ng
    EUR 603

    OXGR1 Protein Vector (Rat) (pPM-C-His)

    PV292025 500 ng
    EUR 603

    OXGR1 Protein Vector (Mouse) (pPB-C-His)

    PV212950 500 ng
    EUR 603

    OXGR1 Protein Vector (Mouse) (pPB-N-His)

    PV212951 500 ng
    EUR 603

    OXGR1 Protein Vector (Mouse) (pPM-C-HA)

    PV212952 500 ng
    EUR 603

    OXGR1 Protein Vector (Mouse) (pPM-C-His)

    PV212953 500 ng
    EUR 603

    Human Oxoglutarate Receptor 1(OXGR1)ELISA Kit

    QY-E01217 96T
    EUR 361

    OXGR1 Protein Vector (Human) (pPB-C-His)

    PV055969 500 ng
    EUR 481

    OXGR1 Protein Vector (Human) (pPB-N-His)

    PV055970 500 ng
    EUR 481

    OXGR1 Protein Vector (Human) (pPM-C-HA)

    PV055971 500 ng
    EUR 329

    OXGR1 Protein Vector (Human) (pPM-C-His)

    PV055972 500 ng
    EUR 481

    OXGR1 Rabbit Polyclonal Antibody