GPR39 Rabbit Polyclonal Antibody

GPR39 Rabbit Polyclonal Antibody

Contact Us Below To Order :

GPR39 Polyclonal Antibody
ABP58690-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human GPR39 protein at amino acid sequence of 140-220 Applications tips:
Description: A polyclonal antibody for detection of GPR39 from Human. This GPR39 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR39 protein at amino acid sequence of 140-220

GPR39 Polyclonal Antibody
ES11472-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against GPR39 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR39 Polyclonal Antibody
ES11472-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against GPR39 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

GPR39 Antibody
37607-100ul	SAB	100ul	EUR 252

GPR39 Antibody
DF2743	Affbiotech	200ul	EUR 304
Description: GPR39 antibody detects endogenous levels of total GPR39.

GPR39 Antibody
DF2805	Affbiotech	200ul	EUR 304
Description: GPR39 antibody detects endogenous levels of total GPR39.

GPR39 Antibody
1-CSB-PA034253	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

GPR39 Antibody
1-CSB-PA009812LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:200-1:500

GPR39 Antibody
ABD2743	Lifescience Market	100 ug	EUR 438

GPR39 Antibody
ABD2805	Lifescience Market	100 ug	EUR 438

Polyclonal GPR39 Antibody (C-term)
AMM08585G	Leading Biology	0.1ml	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (C-term). This antibody is tested and proven to work in the following applications:

Polyclonal GPR39 Antibody (C-Terminus)
APR16561G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR39 Antibody (C-Terminus)
APR16562G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR39 Antibody (C-Terminus)
APR16563G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (C-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR39 Antibody (Extracellular Domain)
APR16564G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR39 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR39 Antibody (internal region)
APR16565G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human GPR39 (internal region). This antibody is tested and proven to work in the following applications:

GPR39 Conjugated Antibody
C37607	SAB	100ul	EUR 397

Anti-GPR39 antibody
STJ192630	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GPR39

GPR39 siRNA
20-abx918524	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Polyclonal Goat Anti-GPR39 Antibody (internal region)
APR16283G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-GPR39 (internal region). This antibody is tested and proven to work in the following applications:

GPR39 Antibody, HRP conjugated
1-CSB-PA009812LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

GPR39 Antibody, FITC conjugated
1-CSB-PA009812LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

GPR39 Antibody, Biotin conjugated
1-CSB-PA009812LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against GPR39. Recognizes GPR39 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

GPR39 Blocking Peptide
DF2743-BP	Affbiotech	1mg	EUR 195

GPR39 Blocking Peptide
DF2805-BP	Affbiotech	1mg	EUR 195

GPR39 cloning plasmid
CSB-CL009812HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1362 Sequence: ATGGCTTCACCCAGCCTCCCGGGCAGTGACTGCTCCCAAATCATTGATCACAGTCATGTCCCCGAGTTTGAGGTGGCCACCTGGATCAAAATCACCCTTATTCTGGTGTACCTGATCATCTTCGTGATGGGCCTTCTGGGGAACAGCGCCACCATTCGGGTCACCCAGGTGCTGC Show more
Description: A cloning plasmid for the GPR39 gene.

Anti-GPR39 (aa377-391) antibody
STJ73166	St John's Laboratory	100 µg	EUR 359

Rabbit Anti-Mouse GPR39 IgG #1 aff pure
GPR391-A	Alpha Diagnostics	100 ug	EUR 482

Rabbit Anti-Mouse GPR39 peptide (NT) antiserum #1
GPR391-S	Alpha Diagnostics	100 ul	EUR 457

Rabbit Anti-Human GPR39 peptide (NT) antiserum #2
GPR392-S	Alpha Diagnostics	100 ul	EUR 457

Human GPR39 shRNA Plasmid
20-abx951922	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

GPR39 Recombinant Protein (Human)
RP039580	ABM	100 ug	Ask for price

GPR39 Recombinant Protein (Rat)
RP203426	ABM	100 ug	Ask for price

GPR39 Recombinant Protein (Rat)
RP203429	ABM	100 ug	Ask for price

GPR39 Recombinant Protein (Mouse)
RP139643	ABM	100 ug	Ask for price

Rabbit G protein coupled receptor 39(GPR39) ELISA kit
E04G0438-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit G protein coupled receptor 39(GPR39) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

GPR39 Rabbit Polyclonal Antibody