LGR5 Rabbit Polyclonal Antibody

LGR5 Rabbit Polyclonal Antibody

Contact Us Below To Order :

LGR5 Polyclonal Antibody
ES11504-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against LGR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

LGR5 Polyclonal Antibody
ES11504-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against LGR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

Polyclonal LGR5 Antibody (loop2)
APR05065G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (loop2). This antibody is tested and proven to work in the following applications:

LGR5 Rabbit pAb
A10545-100ul	Abclonal	100 ul	EUR 308

LGR5 Rabbit pAb
A10545-200ul	Abclonal	200 ul	EUR 459

LGR5 Rabbit pAb
A10545-20ul	Abclonal	20 ul	EUR 183

LGR5 Rabbit pAb
A10545-50ul	Abclonal	50 ul	EUR 223

LGR5 Rabbit pAb
A19489-100ul	Abclonal	100 ul	Ask for price

LGR5 Rabbit pAb
A19489-200ul	Abclonal	200 ul	Ask for price

LGR5 Rabbit pAb
A19489-20ul	Abclonal	20 ul	Ask for price

LGR5 Rabbit pAb
A19489-50ul	Abclonal	50 ul	EUR 308

Polyclonal LGR5 (GPR49) Antibody (loop1)
APR05064G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (GPR49) (loop1). This antibody is tested and proven to work in the following applications:

Polyclonal LGR5 (GPR49) Antibody (Center)
APR05066G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (GPR49) (Center). This antibody is tested and proven to work in the following applications:

LGR5 antibody
20R-2773	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal LGR5 antibody

LGR5 Antibody
A1007-100	Biovision		EUR 354

LGR5 Antibody
44974-100ul	SAB	100ul	EUR 252

LGR5 Antibody
44974-50ul	SAB	50ul	EUR 187

LGR5 Antibody
1-CSB-PA080695	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

LGR5 Antibody
CSB-PA622827-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

LGR5 Antibody
CSB-PA622827-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

LGR5 Antibody
DF2816	Affbiotech	200ul	EUR 304
Description: LGR5 antibody detects endogenous levels of total LGR5.

LGR5 Antibody
AF7530	Affbiotech	200ul	EUR 376
Description: LGR5 Antibody detects endogenous levels of LGR5.

LGR5 Antibody
1-CSB-PA012906LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

LGR5 Antibody
ABD2816	Lifescience Market	100 ug	EUR 438

LGR5/GPR49 Rabbit mAb
A12327-100ul	Abclonal	100 ul	EUR 410

LGR5/GPR49 Rabbit mAb
A12327-200ul	Abclonal	200 ul	EUR 571

LGR5/GPR49 Rabbit mAb
A12327-20ul	Abclonal	20 ul	EUR 221

LGR5/GPR49 Rabbit mAb
A12327-50ul	Abclonal	50 ul	EUR 287

Anti-LGR5/GPR49 Rabbit Monoclonal Antibody
M00239	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal LGR5/GPR49 Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.

Polyclonal GPR49 / LGR5 Antibody (N-Terminus)
APR01956G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (N-Terminus). This antibody is tested and proven to work in the following applications:

Polyclonal GPR49 / LGR5 Antibody (Cytoplasmic Domain)
APR01957G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

Polyclonal GPR49 / LGR5 Antibody (Cytoplasmic Domain)
APR01958G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

LGR5(GPR49) Antibody
21659-100ul	SAB	100ul	EUR 252

LGR5(GPR49) Antibody
21659-50ul	SAB	50ul	EUR 187

LGR5/GPR49 Antibody
48810-100ul	SAB	100ul	EUR 333

LGR5/GPR49 Antibody
48810-50ul	SAB	50ul	EUR 239

LGR5 (GPR49) Antibody
abx020041-100ug	Abbexa	100 ug	EUR 439
Shipped within 5-10 working days.

LGR5 / GPR49 Antibody
abx031681-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

LGR5 / GPR49 Antibody
abx031681-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

LGR5 (loop2) Antibody
abx031683-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

LGR5 (loop2) Antibody
abx031683-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

LGR5(GPR49) Antibody
AF4102	Affbiotech	200ul	EUR 376
Description: The antibody detects endogenous level of total LGR5(GPR49) protein.

LGR5 Conjugated Antibody
C44974	SAB	100ul	EUR 397

LGR5 (GPR49) Antibody
ABF4102	Lifescience Market	100 ug	EUR 438

anti- LGR5 antibody
FNab04765	FN Test	100µg	EUR 585
Recommended dilution: IHC: 1:100-1:400 Immunogen: leucine-rich repeat-containing G protein-coupled receptor 5 Uniprot ID: O75473 Gene ID: 8549 Research Area: Signal Transduction
Description: Antibody raised against LGR5

Anti-LGR5 antibody
PAab04765	Lifescience Market	100 ug	EUR 412

Anti-LGR5 antibody
STJ11100682	St John's Laboratory	50 µl	EUR 287
Description: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. Several transcript variants encoding different isoforms have been found for this gene.

Anti-LGR5 antibody
STJ112563	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. Several transcript variants encoding different isoforms have been found for this gene.

Anti-LGR5 antibody
STJ192662	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to LGR5

LGR5 siRNA
20-abx902972	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LGR5 siRNA
20-abx922502	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LGR5 siRNA
20-abx922503	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

LGR5 (Phospho-Thr842) Antibody
13294-100ul	SAB	100ul	EUR 252

LGR5 (Phospho-Thr842) Antibody
13294-50ul	SAB	50ul	EUR 187

LGR5 (GPR49) (loop1) Antibody
abx031682-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

LGR5 (GPR49) (loop1) Antibody
abx031682-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

LGR5/GPR49 Conjugated Antibody
C48810	SAB	100ul	EUR 397

LGR5(GPR49)  Conjugated Antibody
C21659	SAB	100ul	EUR 397

LGR5 Antibody, HRP conjugated
1-CSB-PA012906LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

LGR5 Antibody, FITC conjugated
1-CSB-PA012906LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

LGR5 Antibody, Biotin conjugated
1-CSB-PA012906LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Phospho-LGR5(Thr842) Antibody
AF7954	Affbiotech	200ul	EUR 376
Description: Phospho-LGR5(Thr842) Antibody detects endogenous levels of LGR5 only when phosphorylated at Thr842.

Antibody for Human LGR5
SPC-764D	Stressmarq	0.1mg	EUR 353
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is unconjugated.

Antibody for Human LGR5
SPC-764D-A390	Stressmarq	0.1mg	EUR 400
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 390.

Antibody for Human LGR5
SPC-764D-A488	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 488.

Antibody for Human LGR5
SPC-764D-A565	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 565.

Antibody for Human LGR5
SPC-764D-A594	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 594.

Antibody for Human LGR5
SPC-764D-A633	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 633.

Antibody for Human LGR5
SPC-764D-A655	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 655.

Antibody for Human LGR5
SPC-764D-A680	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 680.

Antibody for Human LGR5
SPC-764D-A700	Stressmarq	0.1mg	EUR 399
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 700.

Antibody for Human LGR5
SPC-764D-ALP	Stressmarq	0.1mg	EUR 393
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Alkaline Phosphatase.

Antibody for Human LGR5
SPC-764D-APC	Stressmarq	0.1mg	EUR 398
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to APC .

Antibody for Human LGR5
SPC-764D-APCCY7	Stressmarq	0.1mg	EUR 470
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to APC/Cy7.

Antibody for Human LGR5
SPC-764D-BI	Stressmarq	0.1mg	EUR 395
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Biotin.

Antibody for Human LGR5
SPC-764D-DY350	Stressmarq	0.1mg	EUR 413
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 350.

Antibody for Human LGR5
SPC-764D-DY405	Stressmarq	0.1mg	EUR 402
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 405.

Antibody for Human LGR5
SPC-764D-DY488	Stressmarq	0.1mg	EUR 392
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 488.

Antibody for Human LGR5
SPC-764D-DY594	Stressmarq	0.1mg	EUR 394
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 594.

Antibody for Human LGR5
SPC-764D-DY633	Stressmarq	0.1mg	EUR 389
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 633.

Antibody for Human LGR5
SPC-764D-FITC	Stressmarq	0.1mg	EUR 391
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to FITC.

Antibody for Human LGR5
SPC-764D-HRP	Stressmarq	0.1mg	EUR 387
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to HRP.

Antibody for Human LGR5
SPC-764D-P594	Stressmarq	0.1mg	EUR 406
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to PE/ATTO 594.

Antibody for Human LGR5
SPC-764D-PCP	Stressmarq	0.1mg	EUR 398
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to PerCP.

Antibody for Human LGR5
SPC-764D-RPE	Stressmarq	0.1mg	EUR 396
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to RPE .

Antibody for Human LGR5
SPC-764D-STR	Stressmarq	0.1mg	EUR 397
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Streptavidin.

Antibody for Human LGR5
SPC-764S	Stressmarq	0.012mg	EUR 65
Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is unconjugated.

Rabbit Anti-LGR5 monoclonal antibody, clone TV43-15
CABT-L640	Creative Diagnostics	100 ul	EUR 777

GPR49/LGR5 alpha/beta Antibody
48500-100ul	SAB	100ul	EUR 333

GPR49/LGR5 alpha/beta Antibody
48500-50ul	SAB	50ul	EUR 239

LGR5 (Phospho-Thr842) Conjugated Antibody
C13294	SAB	100ul	EUR 397

Monoclonal LGR5 Antibody, Clone: 2B5B9
AMM03068G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human LGR5. The antibodies are raised in Mouse and are from clone 2B5B9. This antibody is applicable in WB and IHC, FC, ICC, E

Monoclonal LGR5 Antibody, Clone: 2B5C3
AMM03069G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human LGR5. The antibodies are raised in Mouse and are from clone 2B5C3. This antibody is applicable in WB and IHC, FC, ICC, E

LGR5 Blocking Peptide
DF2816-BP	Affbiotech	1mg	EUR 195

LGR5 Blocking Peptide
AF7530-BP	Affbiotech	1mg	EUR 195

LGR5 cloning plasmid
CSB-CL012906HU-10ug	Cusabio	10ug	EUR 873
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2724 Sequence: ATGGACACCTCCCGGCTCGGTGTGCTCCTGTCCTTGCCTGTGCTGCTGCAGCTGGCGACCGGGGGCAGCTCTCCCAGGTCTGGTGTGTTGCTGAGGGGCTGCCCCACACACTGTCATTGCGAGCCCGACGGCAGGATGTTGCTCAGGGTGGACTGCTCCGACCTGGGGCTCTCGG Show more
Description: A cloning plasmid for the LGR5 gene.

LGR5 Rabbit Polyclonal Antibody