LGR5 Rabbit Polyclonal Antibody

LGR5 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    LGR5 Polyclonal Antibody
    ES11504-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against LGR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    LGR5 Polyclonal Antibody
    ES11504-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against LGR5 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    LGR5 Rabbit pAb
    A10545-100ul 100 ul
    EUR 308
    LGR5 Rabbit pAb
    A10545-200ul 200 ul
    EUR 459
    LGR5 Rabbit pAb
    A10545-20ul 20 ul
    EUR 183
    LGR5 Rabbit pAb
    A10545-50ul 50 ul
    EUR 223
    LGR5 Rabbit pAb
    A19489-100ul 100 ul Ask for price
    LGR5 Rabbit pAb
    A19489-200ul 200 ul Ask for price
    LGR5 Rabbit pAb
    A19489-20ul 20 ul Ask for price
    LGR5 Rabbit pAb
    A19489-50ul 50 ul
    EUR 308
    Polyclonal LGR5 Antibody (loop2)
    APR05065G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (loop2). This antibody is tested and proven to work in the following applications:
    LGR5/GPR49 Rabbit mAb
    A12327-100ul 100 ul
    EUR 410
    LGR5/GPR49 Rabbit mAb
    A12327-200ul 200 ul
    EUR 571
    LGR5/GPR49 Rabbit mAb
    A12327-20ul 20 ul
    EUR 221
    LGR5/GPR49 Rabbit mAb
    A12327-50ul 50 ul
    EUR 287
    LGR5 antibody
    20R-2773 50 ug
    EUR 281
    Description: Rabbit polyclonal LGR5 antibody
    LGR5 Antibody
    A1007-100
    EUR 354
    LGR5 Antibody
    44974-100ul 100ul
    EUR 252
    LGR5 Antibody
    44974-50ul 50ul
    EUR 187
    LGR5 Antibody
    1-CSB-PA080695
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100
    LGR5 Antibody
    CSB-PA622827-
    EUR 335
    • Form: liquid
    • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
    • Show more
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
    LGR5 Antibody
    CSB-PA622827-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
    • Show more
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000
    LGR5 Antibody
    DF2816 200ul
    EUR 304
    Description: LGR5 antibody detects endogenous levels of total LGR5.
    LGR5 Antibody
    AF7530 200ul
    EUR 376
    Description: LGR5 Antibody detects endogenous levels of LGR5.
    LGR5 Antibody
    1-CSB-PA012906LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200
    LGR5 Antibody
    ABD2816 100 ug
    EUR 438
    Polyclonal LGR5 (GPR49) Antibody (loop1)
    APR05064G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (GPR49) (loop1). This antibody is tested and proven to work in the following applications:
    Polyclonal LGR5 (GPR49) Antibody (Center)
    APR05066G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LGR5 (GPR49) (Center). This antibody is tested and proven to work in the following applications:
    Anti-LGR5/GPR49 Rabbit Monoclonal Antibody
    M00239 100ug/vial
    EUR 397
    Description: Rabbit Monoclonal LGR5/GPR49 Antibody. Validated in Flow Cytometry, IP, WB and tested in Human, Mouse, Rat.
    Polyclonal GPR49 / LGR5 Antibody (N-Terminus)
    APR01956G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (N-Terminus). This antibody is tested and proven to work in the following applications:
    Polyclonal GPR49 / LGR5 Antibody (Cytoplasmic Domain)
    APR01957G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
    Polyclonal GPR49 / LGR5 Antibody (Cytoplasmic Domain)
    APR01958G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR49 / LGR5 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
    LGR5(GPR49) Antibody 
    21659-100ul 100ul
    EUR 252
    LGR5(GPR49) Antibody 
    21659-50ul 50ul
    EUR 187
    LGR5/GPR49 Antibody
    48810-100ul 100ul
    EUR 333
    LGR5/GPR49 Antibody
    48810-50ul 50ul
    EUR 239
    LGR5 (GPR49) Antibody
    abx020041-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.
    LGR5 / GPR49 Antibody
    abx031681-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    LGR5 / GPR49 Antibody
    abx031681-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    LGR5 (loop2) Antibody
    abx031683-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    LGR5 (loop2) Antibody
    abx031683-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    LGR5(GPR49) Antibody
    AF4102 200ul
    EUR 376
    Description: The antibody detects endogenous level of total LGR5(GPR49) protein.
    LGR5 Conjugated Antibody
    C44974 100ul
    EUR 397
    LGR5 (GPR49) Antibody
    ABF4102 100 ug
    EUR 438
    anti- LGR5 antibody
    FNab04765 100µg
    EUR 585
    • Recommended dilution: IHC: 1:100-1:400
    • Immunogen: leucine-rich repeat-containing G protein-coupled receptor 5
    • Uniprot ID: O75473
    • Gene ID: 8549
    • Research Area: Signal Transduction
    Description: Antibody raised against LGR5
    Anti-LGR5 antibody
    PAab04765 100 ug
    EUR 412
    Anti-LGR5 antibody
    STJ11100682 50 µl
    EUR 287
    Description: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. Several transcript variants encoding different isoforms have been found for this gene.
    Anti-LGR5 antibody
    STJ112563 100 µl
    EUR 277
    Description: The protein encoded by this gene is a leucine-rich repeat-containing receptor (LGR) and member of the G protein-coupled, 7-transmembrane receptor (GPCR) superfamily. The encoded protein is a receptor for R-spondins and is involved in the canonical Wnt signaling pathway. This protein plays a role in the formation and maintenance of adult intestinal stem cells during postembryonic development. Several transcript variants encoding different isoforms have been found for this gene.
    Anti-LGR5 antibody
    STJ192662 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to LGR5
    LGR5 siRNA
    20-abx902972
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LGR5 siRNA
    20-abx922502
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LGR5 siRNA
    20-abx922503
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Rabbit Anti-LGR5 monoclonal antibody, clone TV43-15
    CABT-L640 100 ul
    EUR 777
    LGR5 (Phospho-Thr842) Antibody
    13294-100ul 100ul
    EUR 252
    LGR5 (Phospho-Thr842) Antibody
    13294-50ul 50ul
    EUR 187
    LGR5 (GPR49) (loop1) Antibody
    abx031682-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    LGR5 (GPR49) (loop1) Antibody
    abx031682-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    LGR5/GPR49 Conjugated Antibody
    C48810 100ul
    EUR 397
    LGR5(GPR49)  Conjugated Antibody
    C21659 100ul
    EUR 397
    LGR5 Antibody, HRP conjugated
    1-CSB-PA012906LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    LGR5 Antibody, FITC conjugated
    1-CSB-PA012906LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    LGR5 Antibody, Biotin conjugated
    1-CSB-PA012906LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LGR5. Recognizes LGR5 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Phospho-LGR5(Thr842) Antibody
    AF7954 200ul
    EUR 376
    Description: Phospho-LGR5(Thr842) Antibody detects endogenous levels of LGR5 only when phosphorylated at Thr842.
    Antibody for Human LGR5
    SPC-764D 0.1mg
    EUR 353
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is unconjugated.
    Antibody for Human LGR5
    SPC-764D-A390 0.1mg
    EUR 400
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 390.
    Antibody for Human LGR5
    SPC-764D-A488 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 488.
    Antibody for Human LGR5
    SPC-764D-A565 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 565.
    Antibody for Human LGR5
    SPC-764D-A594 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 594.
    Antibody for Human LGR5
    SPC-764D-A633 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 633.
    Antibody for Human LGR5
    SPC-764D-A655 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 655.
    Antibody for Human LGR5
    SPC-764D-A680 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 680.
    Antibody for Human LGR5
    SPC-764D-A700 0.1mg
    EUR 399
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to ATTO 700.
    Antibody for Human LGR5
    SPC-764D-ALP 0.1mg
    EUR 393
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Alkaline Phosphatase.
    Antibody for Human LGR5
    SPC-764D-APC 0.1mg
    EUR 398
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to APC .
    Antibody for Human LGR5
    SPC-764D-APCCY7 0.1mg
    EUR 470
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to APC/Cy7.
    Antibody for Human LGR5
    SPC-764D-BI 0.1mg
    EUR 395
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Biotin.
    Antibody for Human LGR5
    SPC-764D-DY350 0.1mg
    EUR 413
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 350.
    Antibody for Human LGR5
    SPC-764D-DY405 0.1mg
    EUR 402
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 405.
    Antibody for Human LGR5
    SPC-764D-DY488 0.1mg
    EUR 392
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 488.
    Antibody for Human LGR5
    SPC-764D-DY594 0.1mg
    EUR 394
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 594.
    Antibody for Human LGR5
    SPC-764D-DY633 0.1mg
    EUR 389
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Dylight 633.
    Antibody for Human LGR5
    SPC-764D-FITC 0.1mg
    EUR 391
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to FITC.
    Antibody for Human LGR5
    SPC-764D-HRP 0.1mg
    EUR 387
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to HRP.
    Antibody for Human LGR5
    SPC-764D-P594 0.1mg
    EUR 406
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to PE/ATTO 594.
    Antibody for Human LGR5
    SPC-764D-PCP 0.1mg
    EUR 398
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to PerCP.
    Antibody for Human LGR5
    SPC-764D-RPE 0.1mg
    EUR 396
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to RPE .
    Antibody for Human LGR5
    SPC-764D-STR 0.1mg
    EUR 397
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is conjugated to Streptavidin.
    Antibody for Human LGR5
    SPC-764S 0.012mg
    EUR 65
    Description: A polyclonal antibody for LGR5 from Human. The antibody is produced in rabbit after immunization with human synthetic peptide from the mid-protein of Human LGR5 (aa. 500-600). The Antibody is tested and validated for WB assays with the following recommended dilutions: WB (1:1000). This LGR5 antibody is unconjugated.
    LGR5 Blocking Peptide
    DF2816-BP 1mg
    EUR 195
    LGR5 Blocking Peptide
    AF7530-BP 1mg
    EUR 195
    LGR5 cloning plasmid
    CSB-CL012906HU-10ug 10ug
    EUR 873
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2724
    • Sequence: ATGGACACCTCCCGGCTCGGTGTGCTCCTGTCCTTGCCTGTGCTGCTGCAGCTGGCGACCGGGGGCAGCTCTCCCAGGTCTGGTGTGTTGCTGAGGGGCTGCCCCACACACTGTCATTGCGAGCCCGACGGCAGGATGTTGCTCAGGGTGGACTGCTCCGACCTGGGGCTCTCGG
    • Show more
    Description: A cloning plasmid for the LGR5 gene.
    GPR49/LGR5 alpha/beta Antibody
    48500-100ul 100ul
    EUR 333
    GPR49/LGR5 alpha/beta Antibody
    48500-50ul 50ul
    EUR 239
    LGR5 (Phospho-Thr842) Conjugated Antibody
    C13294 100ul
    EUR 397
    Monoclonal LGR5 Antibody, Clone: 2B5B9
    AMM03068G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human LGR5. The antibodies are raised in Mouse and are from clone 2B5B9. This antibody is applicable in WB and IHC, FC, ICC, E
    Monoclonal LGR5 Antibody, Clone: 2B5C3
    AMM03069G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human LGR5. The antibodies are raised in Mouse and are from clone 2B5C3. This antibody is applicable in WB and IHC, FC, ICC, E
    Monoclonal LGR5/GPR49 Antibody, Clone: 349CT16.1.3.1
    AMM02389G 0.1ml
    EUR 484
    Description: A Monoclonal antibody against Human LGR5/GPR49. The antibodies are raised in Mouse and are from clone 349CT16.1.3.1. This antibody is applicable in FC, WB, E
    Mouse Lgr5 ELISA KIT
    ELI-14463m 96 Tests
    EUR 865
    LGR5 ELISA KIT|Human
    EF010665 96 Tests
    EUR 689
    Human LGR5 ELISA KIT
    ELI-43187h 96 Tests
    EUR 824

    LGR5 Rabbit Polyclonal Antibody