MC3R Rabbit Polyclonal Antibody

MC3R Rabbit Polyclonal Antibody

Contact Us Below To Order :

    MC3R Polyclonal Antibody

    ES11655-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MC3R from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MC3R Polyclonal Antibody

    ES11655-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MC3R from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    MC3R Rabbit pAb

    A11609-100ul 100 ul
    EUR 308

    MC3R Rabbit pAb

    A11609-200ul 200 ul
    EUR 459

    MC3R Rabbit pAb

    A11609-20ul 20 ul
    EUR 183

    MC3R Rabbit pAb

    A11609-50ul 50 ul
    EUR 223

    MC3R Rabbit pAb

    A11654-100ul 100 ul
    EUR 308

    MC3R Rabbit pAb

    A11654-200ul 200 ul
    EUR 459

    MC3R Rabbit pAb

    A11654-20ul 20 ul
    EUR 183

    MC3R Rabbit pAb

    A11654-50ul 50 ul
    EUR 223

    MC3R Rabbit pAb

    A3011-100ul 100 ul
    EUR 308

    MC3R Rabbit pAb

    A3011-200ul 200 ul
    EUR 459

    MC3R Rabbit pAb

    A3011-20ul 20 ul
    EUR 183

    MC3R Rabbit pAb

    A3011-50ul 50 ul
    EUR 223

    Polyclonal MC3R Antibody (Center)

    APR08365G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MC3R (Center). This antibody is tested and proven to work in the following applications:

    MC3R Antibody

    36971-100ul 100ul
    EUR 252

    MC3R antibody

    38535-100ul 100ul
    EUR 252

    MC3R Antibody

    CSB-PA261897-
    EUR 335
    • Form: liquid
    • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
    Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

    MC3R Antibody

    CSB-PA261897-100ul 100ul
    EUR 316
    • Form: liquid
    • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
    Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

    MC3R Antibody

    1-CSB-PA013560LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:200-1:500, IF:1:50-1:200

    Polyclonal MC3R Antibody (C-term)

    APR08364G 0.1ml
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MC3R (C-term). This antibody is tested and proven to work in the following applications:

    MC3R Polyclonal Antibody, HRP Conjugated

    A69588 100 ?g
    EUR 628.55
    Description: Ask the seller for details

    MC3R Polyclonal Antibody, FITC Conjugated

    A69589 100 ?g
    EUR 628.55
    Description: The best epigenetics products

    MC3R Polyclonal Antibody, Biotin Conjugated

    A69590 100 ?g
    EUR 628.55
    Description: kits suitable for this type of research

    MC3R Conjugated Antibody

    C36971 100ul
    EUR 397

    MC3R Conjugated Antibody

    C38535 100ul
    EUR 397

    anti- MC3R antibody

    FNab05045 100µg
    EUR 585
    • Immunogen: melanocortin 3 receptor
    • Uniprot ID: P41968
    • Gene ID: 4159
    • Research Area: Neuroscience, Signal Transduction
    Description: Antibody raised against MC3R

    Anti-MC3R antibody

    PAab05045 100 ug
    EUR 412

    Anti-MC3R antibody

    STJ27686 100 µl
    EUR 277
    Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

    Anti-MC3R antibody

    STJ113214 100 µl
    EUR 277
    Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

    Anti-MC3R antibody

    STJ113256 100 µl
    EUR 277
    Description: This gene encodes a G-protein-coupled receptor for melanocyte-stimulating hormone and adrenocorticotropic hormone that is expressed in tissues other than the adrenal cortex and melanocytes. This gene maps to the same region as the locus for benign neonatal epilepsy. Mice deficient for this gene have increased fat mass despite decreased food intake, suggesting a role for this gene product in the regulation of energy homeostasis. Mutations in this gene are associated with a susceptibility to obesity in humans.

    Anti-MC3R Antibody

    STJ501725 100 µg
    EUR 476

    Anti-MC3R antibody

    STJ192813 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to MC3R

    Mc3r/ Rat Mc3r ELISA Kit

    ELI-43039r 96 Tests
    EUR 886

    MC3R siRNA

    20-abx903183
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MC3R siRNA

    20-abx923695
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MC3R siRNA

    20-abx923696
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    MC3R Antibody, HRP conjugated

    1-CSB-PA013560LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    MC3R Antibody, FITC conjugated

    1-CSB-PA013560LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    MC3R Antibody, Biotin conjugated

    1-CSB-PA013560LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against MC3R. Recognizes MC3R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Anti-MC3R Antibody (Biotin)

    STJ501730 100 µg
    EUR 586

    Anti-MC3R Antibody (FITC)

    STJ501731 100 µg
    EUR 586

    MC3R cloning plasmid

    CSB-CL013560HU1-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1083
    • Sequence: atgagcatccaaaagacgtatctggagggagattttgtctttcctgtgagcagcagcagcttcctacggaccctgctggagccccagctcggatcagcccttctgacagcaatgaatgcttcgtgctgcctgccctctgttcagccaacactgcctaatggctcggagcacctcc
    • Show more
    Description: A cloning plasmid for the MC3R gene.

    MC3R cloning plasmid

    CSB-CL013560HU2-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1083
    • Sequence: ATGAGCATCCAAAAGACGTATCTGGAGGGAGATTTTGTCTTTCCTGTGAGCAGCAGCAGCTTCCTACGGACCCTGCTGGAGCCCCAGCTCGGATCAGCCCTTCTGACAGCAATGAATGCTTCGTGCTGCCTGCCCTCTGTTCAGCCAACACTGCCTAATGGCTCGGAGCACCTCC
    • Show more
    Description: A cloning plasmid for the MC3R gene.

    Anti-MC3 Receptor/MC3R Antibody

    A02841-2 100ug/vial
    EUR 294

    Melanocortin 3 Receptor (MC3R) Antibody

    20-abx126135
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody

    20-abx126136
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody

    abx034077-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody

    abx034077-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody

    abx235045-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Melanocortin 3 Receptor (MC3R) Antibody

    abx332792-100ul 100 ul
    EUR 425
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody

    20-abx334291
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody

    abx432962-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Melanocortin 3 Receptor (MC3R) Antibody

    20-abx002184
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody (HRP)

    20-abx336468
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody (FITC)

    20-abx336469
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Melanocortin 3 Receptor (MC3R) Antibody (Biotin)

    20-abx336470
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    MC3R ELISA KIT|Human

    EF010862 96 Tests
    EUR 689

    Rat MC3R shRNA Plasmid

    20-abx985417
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human MC3R shRNA Plasmid

    20-abx952831
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse MC3R shRNA Plasmid

    20-abx971456
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    MC3R Recombinant Protein (Human)

    RP018946 100 ug Ask for price

    MC3R Recombinant Protein (Human)

    RP041278 100 ug Ask for price

    MC3R Recombinant Protein (Mouse)

    RP149756 100 ug Ask for price

    MC3R Recombinant Protein (Rat)

    RP211067 100 ug Ask for price

    Rabbit Anti-Human Melanocortin Receptor 3 (MC3R) antiserum # 1

    MCR31-S 100 ul
    EUR 457

    Rabbit Anti-Mouse Melanocortin Receptor 3 (MC3R) antiserum # 2

    MCR32-S 100 ul
    EUR 457

    Mc3r ORF Vector (Rat) (pORF)

    ORF070357 1.0 ug DNA
    EUR 506

    MC3R ORF Vector (Human) (pORF)

    ORF006316 1.0 ug DNA
    EUR 95

    MC3R ORF Vector (Human) (pORF)

    ORF013760 1.0 ug DNA
    EUR 354

    Mc3r ORF Vector (Mouse) (pORF)

    ORF049920 1.0 ug DNA
    EUR 506

    MC3R ELISA Kit (Rat) (OKEI00933)

    OKEI00933 96 Wells
    EUR 767
    Description: Description of target: Receptor for MSH (alpha, beta and gamma) and ACTH. This receptor is mediated by G proteins which activate adenylate cyclase. Required for expression of anticipatory patterns of activity and wakefulness during periods of limited nutrient availability and for the normal regulation of circadian clock activity in the brain.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 46.9 pg/mL

    Rabbit Anti-Human Melanocortin Receptor 3 (MC3R) IgG # 1, aff pure

    MCR31-A 100 ug
    EUR 482

    Rabbit Anti-Mouse Melanocortin Receptor 3 (MC3R) IgG # 2, aff pure

    MCR32-A 100 ug
    EUR 482

    Mc3r sgRNA CRISPR Lentivector set (Rat)

    K6870301 3 x 1.0 ug
    EUR 339

    MC3R sgRNA CRISPR Lentivector set (Human)

    K1277001 3 x 1.0 ug
    EUR 339

    Mc3r sgRNA CRISPR Lentivector set (Mouse)

    K4443101 3 x 1.0 ug
    EUR 339

    Human Melanocortin receptor 3, MC3R ELISA KIT

    ELI-43038h 96 Tests
    EUR 824

    Rat Melanocortin Receptor 3 (MC3R) ELISA Kit

    abx354241-96tests 96 tests
    EUR 786
    • Shipped within 5-12 working days.

    Human Melanocortin 3 Receptor (MC3R) ELISA Kit

    abx388449-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.

    Mouse Melanocortin receptor 3, Mc3r ELISA KIT

    ELI-39668m 96 Tests
    EUR 865

    Mc3r sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6870302 1.0 ug DNA
    EUR 154

    Mc3r sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6870303 1.0 ug DNA
    EUR 154

    Mc3r sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6870304 1.0 ug DNA
    EUR 154

    MC3R sgRNA CRISPR Lentivector (Human) (Target 1)

    K1277002 1.0 ug DNA
    EUR 154

    MC3R sgRNA CRISPR Lentivector (Human) (Target 2)

    K1277003 1.0 ug DNA
    EUR 154

    MC3R sgRNA CRISPR Lentivector (Human) (Target 3)

    K1277004 1.0 ug DNA
    EUR 154

    Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4443102 1.0 ug DNA
    EUR 154

    Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4443103 1.0 ug DNA
    EUR 154

    Mc3r sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4443104 1.0 ug DNA
    EUR 154

    MC3R Protein Vector (Human) (pPB-C-His)

    PV025261 500 ng
    EUR 329

    MC3R Protein Vector (Human) (pPB-N-His)

    PV025262 500 ng
    EUR 329

    MC3R Protein Vector (Human) (pPM-C-HA)

    PV025263 500 ng
    EUR 329

    MC3R Protein Vector (Human) (pPM-C-His)

    PV025264 500 ng
    EUR 329

    MC3R Protein Vector (Rat) (pPB-C-His)

    PV281426 500 ng
    EUR 603

    MC3R Protein Vector (Rat) (pPB-N-His)

    PV281427 500 ng
    EUR 603

    MC3R Rabbit Polyclonal Antibody