GPR61 Rabbit Polyclonal Antibody

GPR61 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    GPR61 Polyclonal Antibody

    ABP58695-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human GPR61 protein at amino acid sequence of 190-270
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR61 from Human, Mouse. This GPR61 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR61 protein at amino acid sequence of 190-270

    GPR61 Polyclonal Antibody

    ABP58695-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human GPR61 protein at amino acid sequence of 190-270
    • Applications tips:
    Description: A polyclonal antibody for detection of GPR61 from Human, Mouse. This GPR61 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human GPR61 protein at amino acid sequence of 190-270

    GPR61 Antibody

    ABD2755 100 ug
    EUR 438

    GPR61 Antibody

    ABD2810 100 ug
    EUR 438

    GPR61 Antibody

    44933-100ul 100ul
    EUR 252

    GPR61 Antibody

    44933-50ul 50ul
    EUR 187

    GPR61 antibody

    20R-GR035 50 ug
    EUR 656
    Description: Rabbit polyclonal GPR61 antibody

    GPR61 antibody

    20R-GR069 50 ug
    EUR 656
    Description: Rabbit polyclonal GPR61 antibody

    GPR61 antibody

    20R-GR070 50 ug
    EUR 656
    Description: Rabbit polyclonal GPR61 antibody

    GPR61 Antibody

    DF2755 200ul
    EUR 304
    Description: GPR61 antibody detects endogenous levels of total GPR61.

    GPR61 Antibody

    DF2810 200ul
    EUR 304
    Description: GPR61 antibody detects endogenous levels of total GPR61.

    Polyclonal GPR61 Antibody (C-Terminus)

    APR16588G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR61 Antibody (C-Terminus)

    APR16589G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (C-Terminus). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR61 Antibody (Cytoplasmic Domain)

    APR16590G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR61 Antibody (Extracellular Domain)

    APR16591G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (Extracellular Domain). This antibody is tested and proven to work in the following applications:

    Polyclonal GPR61 Antibody (N-Terminus)

    APR16592G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPR61 (N-Terminus). This antibody is tested and proven to work in the following applications:

    GPR61 Conjugated Antibody

    C44933 100ul
    EUR 397

    Anti-GPR61 antibody

    STJ192635 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to GPR61

    GPR61 siRNA

    20-abx918539
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    GPR61 siRNA

    20-abx918540
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-GPR61

    YF-PA21277 50 ug
    EUR 363
    Description: Mouse polyclonal to GPR61

    GPR61 cloning plasmid

    CSB-CL866330HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1356
    • Sequence: atggagtcctcacccatcccccagtcatcagggaactcttccactttggggagggtccctcaaaccccaggtccctctactgccagtggggtcccggaggtggggctacgggatgttgcttcggaatctgtggccctcttcttcatgctcctgctggacttgactgctgtggctg
    • Show more
    Description: A cloning plasmid for the GPR61 gene.

    GPR61 Blocking Peptide

    DF2755-BP 1mg
    EUR 195

    GPR61 Blocking Peptide

    DF2810-BP 1mg
    EUR 195

    Human GPR61 shRNA Plasmid

    20-abx963213
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse GPR61 shRNA Plasmid

    20-abx981729
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    GPR61 Recombinant Protein (Human)

    RP013882 100 ug Ask for price

    GPR61 Recombinant Protein (Rat)

    RP203447 100 ug Ask for price

    GPR61 Recombinant Protein (Mouse)

    RP139673 100 ug Ask for price

    GPR61 ORF Vector (Human) (pORF)

    ORF004628 1.0 ug DNA
    EUR 95

    Gpr61 ORF Vector (Rat) (pORF)

    ORF067817 1.0 ug DNA
    EUR 506

    Gpr61 ORF Vector (Mouse) (pORF)

    ORF046559 1.0 ug DNA
    EUR 506

    Probable G-Protein Coupled Receptor 61 (GPR61) Antibody

    20-abx147479
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Probable G-Protein Coupled Receptor 61 (GPR61) Antibody

    abx147480-100ug 100 ug
    EUR 439
    • Shipped within 5-10 working days.

    GPR61 sgRNA CRISPR Lentivector set (Human)

    K0892201 3 x 1.0 ug
    EUR 339

    Gpr61 sgRNA CRISPR Lentivector set (Mouse)

    K3882801 3 x 1.0 ug
    EUR 339

    Gpr61 sgRNA CRISPR Lentivector set (Rat)

    K6526201 3 x 1.0 ug
    EUR 339

    GPR61 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0892202 1.0 ug DNA
    EUR 154

    GPR61 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0892203 1.0 ug DNA
    EUR 154

    GPR61 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0892204 1.0 ug DNA
    EUR 154

    Gpr61 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3882802 1.0 ug DNA
    EUR 154

    Gpr61 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3882803 1.0 ug DNA
    EUR 154

    Gpr61 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3882804 1.0 ug DNA
    EUR 154

    Gpr61 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6526202 1.0 ug DNA
    EUR 154

    Gpr61 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6526203 1.0 ug DNA
    EUR 154

    Gpr61 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6526204 1.0 ug DNA
    EUR 154

    GPR61 Rabbit Polyclonal Antibody