PTH2R Rabbit Polyclonal Antibody

PTH2R Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PTH2R Polyclonal Antibody

    ABP60024-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human PTH2R protein at amino acid sequence of 160-240
    • Applications tips:
    Description: A polyclonal antibody for detection of PTH2R from Human, Mouse, Rat. This PTH2R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTH2R protein at amino acid sequence of 160-240

    PTH2R Polyclonal Antibody

    A54886 100 µg
    EUR 570.55
    Description: Ask the seller for details

    PTH2R Polyclonal Antibody

    30517-100ul 100ul
    EUR 252

    PTH2R Polyclonal Antibody

    30517-50ul 50ul
    EUR 187

    PTH2R Rabbit pAb

    A4058-100ul 100 ul
    EUR 308

    PTH2R Rabbit pAb

    A4058-200ul 200 ul
    EUR 459

    PTH2R Rabbit pAb

    A4058-20ul 20 ul
    EUR 183

    PTH2R Rabbit pAb

    A4058-50ul 50 ul
    EUR 223

    PTH2R Polyclonal Conjugated Antibody

    C30517 100ul
    EUR 397

    PTH2R antibody

    70R-19629 50 ul
    EUR 435
    Description: Rabbit polyclonal PTH2R antibody

    PTH2R Antibody

    1-CSB-PA018990GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    PTH2R Antibody

    1-CSB-PA018990LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

    PTH2R Polyclonal Antibody, Biotin Conjugated

    A54883 100 µg
    EUR 570.55
    Description: reagents widely cited

    PTH2R Polyclonal Antibody, FITC Conjugated

    A54884 100 µg
    EUR 570.55
    Description: Ask the seller for details

    PTH2R Polyclonal Antibody, HRP Conjugated

    A54885 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Polyclonal PTHR2 / PTH2R Antibody (C-Terminus)

    AMR09630G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTHR2 / PTH2R (C-Terminus). This antibody is tested and proven to work in the following applications:

    Pth2r/ Rat Pth2r ELISA Kit

    ELI-15494r 96 Tests
    EUR 886

    anti- PTH2R antibody

    FNab06921 100µg
    EUR 548.75
    • Immunogen: parathyroid hormone 2 receptor
    • Uniprot ID: P49190
    • Gene ID: 5746
    • Research Area: Signal Transduction
    Description: Antibody raised against PTH2R

    Anti-PTH2R antibody

    PAab06921 100 ug
    EUR 386

    Anti-PTH2R antibody

    STJ117808 100 µl
    EUR 277
    Description: The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants.

    Anti-PTH2R antibody

    STJ192789 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PTH2R

    PTH2R siRNA

    20-abx904358
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTH2R siRNA

    20-abx930315
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTH2R siRNA

    20-abx930316
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    PTH2R Antibody, HRP conjugated

    1-CSB-PA018990LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    PTH2R Antibody, FITC conjugated

    1-CSB-PA018990LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    PTH2R Antibody, Biotin conjugated

    1-CSB-PA018990LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    PTH2R cloning plasmid

    CSB-CL018990HU-10ug 10ug
    EUR 573
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1653
    • Sequence: atggccgggctgggggcgtcgctccacgtctggggttggctaatgctcggcagctgcctcctggccagagcccagctggattctgatggcaccattactatagaggagcagattgtccttgtgctgaaagcgaaagtacaatgtgaactcaacatcacagctcaactccaggagg
    • Show more
    Description: A cloning plasmid for the PTH2R gene.

    Rabbit Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    abx362739-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Mouse PTH2R shRNA Plasmid

    20-abx980817
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat PTH2R shRNA Plasmid

    20-abx986687
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    PTH2R ELISA KIT|Human

    EF002161 96 Tests
    EUR 689

    Human PTH2R shRNA Plasmid

    20-abx953888
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Parathyroid Hormone 2 Receptor (PTH2R) Antibody

    20-abx114334
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Parathyroid Hormone 2 Receptor (PTH2R) Antibody

    20-abx110696
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Parathyroid Hormone Receptor 2 (PTH2R) Antibody

    abx122357-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Parathyroid Hormone Receptor 2 (PTH2R) Antibody

    abx236921-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    PTH2R ORF Vector (Human) (pORF)

    ORF008378 1.0 ug DNA
    EUR 95

    Pth2r ORF Vector (Rat) (pORF)

    ORF074287 1.0 ug DNA
    EUR 506

    Pth2r ORF Vector (Mouse) (pORF)

    ORF055185 1.0 ug DNA
    EUR 506

    PTH2R ELISA Kit (Human) (OKCD00801)

    OKCD00801 96 Wells
    EUR 792
    Description: Description of target: This is a specific receptor for parathyroid hormone. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. PTH2R may be responsible for PTH effects in a number of physiological systems. It may play a significant role in pancreatic function. PTH2R presence in neurons indicates that it may function as a neurotransmitter receptor (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL

    PTH2R ELISA Kit (Mouse) (OKEI00501)

    OKEI00501 96 Wells
    EUR 767
    Description: Description of target: This is a specific receptor for parathyroid hormone. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. PTH2R may be responsible for PTH effects in a number of physiological systems. It may play a significant role in pancreatic function. PTH2R presence in neurons indicates that it may function as a neurotransmitter receptor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL

    PTH2R sgRNA CRISPR Lentivector set (Human)

    K1752001 3 x 1.0 ug
    EUR 339

    Pth2r sgRNA CRISPR Lentivector set (Mouse)

    K3591901 3 x 1.0 ug
    EUR 339

    Human Parathyroid hormone 2 receptor (PTH2R)

    1-CSB-EP018990HU
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 29.6 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Parathyroid hormone 2 receptor(PTH2R),partial expressed in E.coli

    Pth2r sgRNA CRISPR Lentivector set (Rat)

    K7009001 3 x 1.0 ug
    EUR 339

    PTH2R sgRNA CRISPR Lentivector (Human) (Target 1)

    K1752002 1.0 ug DNA
    EUR 154

    PTH2R sgRNA CRISPR Lentivector (Human) (Target 2)

    K1752003 1.0 ug DNA
    EUR 154

    PTH2R sgRNA CRISPR Lentivector (Human) (Target 3)

    K1752004 1.0 ug DNA
    EUR 154

    Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3591902 1.0 ug DNA
    EUR 154

    Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3591903 1.0 ug DNA
    EUR 154

    Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3591904 1.0 ug DNA
    EUR 154

    Pth2r sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7009002 1.0 ug DNA
    EUR 154

    Pth2r sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7009003 1.0 ug DNA
    EUR 154

    Pth2r sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7009004 1.0 ug DNA
    EUR 154

    PTH2R Protein Vector (Human) (pPB-C-His)

    PV033509 500 ng
    EUR 329

    PTH2R Protein Vector (Human) (pPB-N-His)

    PV033510 500 ng
    EUR 329

    PTH2R Protein Vector (Human) (pPM-C-HA)

    PV033511 500 ng
    EUR 329

    PTH2R Protein Vector (Human) (pPM-C-His)

    PV033512 500 ng
    EUR 329

    PTH2R Protein Vector (Rat) (pPB-C-His)

    PV297146 500 ng
    EUR 603

    PTH2R Protein Vector (Rat) (pPB-N-His)

    PV297147 500 ng
    EUR 603

    PTH2R Protein Vector (Rat) (pPM-C-HA)

    PV297148 500 ng
    EUR 603

    PTH2R Protein Vector (Rat) (pPM-C-His)

    PV297149 500 ng
    EUR 603

    PTH2R Protein Vector (Mouse) (pPB-C-His)

    PV220738 500 ng
    EUR 603

    PTH2R Protein Vector (Mouse) (pPB-N-His)

    PV220739 500 ng
    EUR 603

    PTH2R Protein Vector (Mouse) (pPM-C-HA)

    PV220740 500 ng
    EUR 603

    PTH2R Protein Vector (Mouse) (pPM-C-His)

    PV220741 500 ng
    EUR 603

    Pth2r 3'UTR GFP Stable Cell Line

    TU167250 1.0 ml Ask for price

    PTH2R 3'UTR Luciferase Stable Cell Line

    TU019165 1.0 ml
    EUR 1394

    Pth2r 3'UTR Luciferase Stable Cell Line

    TU117250 1.0 ml Ask for price

    PTH2R 3'UTR GFP Stable Cell Line

    TU069165 1.0 ml
    EUR 1394

    Pth2r 3'UTR GFP Stable Cell Line

    TU267043 1.0 ml Ask for price

    Pth2r 3'UTR Luciferase Stable Cell Line

    TU217043 1.0 ml Ask for price

    Rat Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    abx570112-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Pig Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    abx360916-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Human PTH2R/ Parathyroid hormone 2 receptor ELISA Kit

    E2943Hu 1 Kit
    EUR 605

    Human Parathyroid hormone 2 receptor, PTH2R ELISA KIT

    ELI-14038h 96 Tests
    EUR 824

    Mouse Parathyroid hormone 2 receptor, Pth2r ELISA KIT

    ELI-15072m 96 Tests
    EUR 865

    Human Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    20-abx152888
    • EUR 6642.00
    • EUR 3542.00
    • EUR 825.00
    • 10 × 96 tests
    • 5 × 96 tests
    • 96 tests
    • Shipped within 5-7 working days.

    Human Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    abx351758-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    Mouse Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    abx352930-96tests 96 tests
    EUR 668
    • Shipped within 5-12 working days.

    Chicken Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    abx356299-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Monkey Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    abx359343-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Rat Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit

    abx255963-96tests 96 tests
    EUR 707
    • Shipped within 5-12 working days.

    PTH2R Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

    LV652525 1.0 ug DNA
    EUR 682

    PTH2R Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

    LV652529 1.0 ug DNA
    EUR 682

    PTH2R Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

    LV652530 1.0 ug DNA
    EUR 682

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    PTH2R Rabbit Polyclonal Antibody