PTH2R Rabbit Polyclonal Antibody

PTH2R Rabbit Polyclonal Antibody

Contact Us Below To Order :

PTH2R Polyclonal Antibody
ABP60024-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PTH2R protein at amino acid sequence of 160-240 Applications tips:
Description: A polyclonal antibody for detection of PTH2R from Human, Mouse, Rat. This PTH2R antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PTH2R protein at amino acid sequence of 160-240

PTH2R Polyclonal Antibody
A54886	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

PTH2R Polyclonal Antibody
30517-100ul	SAB	100ul	EUR 252

PTH2R Polyclonal Antibody
30517-50ul	SAB	50ul	EUR 187

PTH2R Rabbit pAb
A4058-100ul	Abclonal	100 ul	EUR 308

PTH2R Rabbit pAb
A4058-200ul	Abclonal	200 ul	EUR 459

PTH2R Rabbit pAb
A4058-20ul	Abclonal	20 ul	EUR 183

PTH2R Rabbit pAb
A4058-50ul	Abclonal	50 ul	EUR 223

PTH2R Polyclonal Conjugated Antibody
C30517	SAB	100ul	EUR 397

PTH2R antibody
70R-19629	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal PTH2R antibody

PTH2R Antibody
1-CSB-PA018990GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PTH2R Antibody
1-CSB-PA018990LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

PTH2R Polyclonal Antibody, Biotin Conjugated
A54883	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

PTH2R Polyclonal Antibody, FITC Conjugated
A54884	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

PTH2R Polyclonal Antibody, HRP Conjugated
A54885	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

Polyclonal PTHR2 / PTH2R Antibody (C-Terminus)
AMR09630G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PTHR2 / PTH2R (C-Terminus). This antibody is tested and proven to work in the following applications:

Pth2r/ Rat Pth2r ELISA Kit
ELI-15494r	Lifescience Market	96 Tests	EUR 886

anti- PTH2R antibody
FNab06921	FN Test	100µg	EUR 548.75
Immunogen: parathyroid hormone 2 receptor Uniprot ID: P49190 Gene ID: 5746 Research Area: Signal Transduction
Description: Antibody raised against PTH2R

Anti-PTH2R antibody
PAab06921	Lifescience Market	100 ug	EUR 386

Anti-PTH2R antibody
STJ117808	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene is a member of the G-protein coupled receptor 2 family. This protein is a receptor for parathyroid hormone (PTH). This receptor is more selective in ligand recognition and has a more specific tissue distribution compared to parathyroid hormone receptor 1 (PTHR1). It is activated only by PTH and not by parathyroid hormone-like hormone (PTHLH) and is particularly abundant in brain and pancreas. Alternative splicing results in multiple transcript variants.

Anti-PTH2R antibody
STJ192789	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PTH2R

PTH2R siRNA
20-abx904358	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTH2R siRNA
20-abx930315	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTH2R siRNA
20-abx930316	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PTH2R Antibody, HRP conjugated
1-CSB-PA018990LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PTH2R Antibody, FITC conjugated
1-CSB-PA018990LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PTH2R Antibody, Biotin conjugated
1-CSB-PA018990LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PTH2R. Recognizes PTH2R from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

PTH2R cloning plasmid
CSB-CL018990HU-10ug	Cusabio	10ug	EUR 573
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1653 Sequence: atggccgggctgggggcgtcgctccacgtctggggttggctaatgctcggcagctgcctcctggccagagcccagctggattctgatggcaccattactatagaggagcagattgtccttgtgctgaaagcgaaagtacaatgtgaactcaacatcacagctcaactccaggagg Show more
Description: A cloning plasmid for the PTH2R gene.

Rabbit Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
abx362739-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Mouse PTH2R shRNA Plasmid
20-abx980817	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat PTH2R shRNA Plasmid
20-abx986687	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PTH2R ELISA KIT|Human
EF002161	Lifescience Market	96 Tests	EUR 689

Human PTH2R shRNA Plasmid
20-abx953888	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Parathyroid Hormone 2 Receptor (PTH2R) Antibody
20-abx114334	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Parathyroid Hormone 2 Receptor (PTH2R) Antibody
20-abx110696	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Parathyroid Hormone Receptor 2 (PTH2R) Antibody
abx122357-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Parathyroid Hormone Receptor 2 (PTH2R) Antibody
abx236921-100ug	Abbexa	100 ug	EUR 509
Shipped within 5-12 working days.

PTH2R ORF Vector (Human) (pORF)
ORF008378	ABM	1.0 ug DNA	EUR 95

Pth2r ORF Vector (Rat) (pORF)
ORF074287	ABM	1.0 ug DNA	EUR 506

Pth2r ORF Vector (Mouse) (pORF)
ORF055185	ABM	1.0 ug DNA	EUR 506

PTH2R ELISA Kit (Human) (OKCD00801)
OKCD00801	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This is a specific receptor for parathyroid hormone. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. PTH2R may be responsible for PTH effects in a number of physiological systems. It may play a significant role in pancreatic function. PTH2R presence in neurons indicates that it may function as a neurotransmitter receptor (By similarity).By similarity ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.118 ng/mL

PTH2R ELISA Kit (Mouse) (OKEI00501)
OKEI00501	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: This is a specific receptor for parathyroid hormone. The activity of this receptor is mediated by G proteins which activate adenylyl cyclase. PTH2R may be responsible for PTH effects in a number of physiological systems. It may play a significant role in pancreatic function. PTH2R presence in neurons indicates that it may function as a neurotransmitter receptor.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.469 ng/mL

PTH2R sgRNA CRISPR Lentivector set (Human)
K1752001	ABM	3 x 1.0 ug	EUR 339

Pth2r sgRNA CRISPR Lentivector set (Mouse)
K3591901	ABM	3 x 1.0 ug	EUR 339

Human Parathyroid hormone 2 receptor (PTH2R)
1-CSB-EP018990HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 29.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Parathyroid hormone 2 receptor(PTH2R),partial expressed in E.coli

Pth2r sgRNA CRISPR Lentivector set (Rat)
K7009001	ABM	3 x 1.0 ug	EUR 339

PTH2R sgRNA CRISPR Lentivector (Human) (Target 1)
K1752002	ABM	1.0 ug DNA	EUR 154

PTH2R sgRNA CRISPR Lentivector (Human) (Target 2)
K1752003	ABM	1.0 ug DNA	EUR 154

PTH2R sgRNA CRISPR Lentivector (Human) (Target 3)
K1752004	ABM	1.0 ug DNA	EUR 154

Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3591902	ABM	1.0 ug DNA	EUR 154

Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3591903	ABM	1.0 ug DNA	EUR 154

Pth2r sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3591904	ABM	1.0 ug DNA	EUR 154

Pth2r sgRNA CRISPR Lentivector (Rat) (Target 1)
K7009002	ABM	1.0 ug DNA	EUR 154

Pth2r sgRNA CRISPR Lentivector (Rat) (Target 2)
K7009003	ABM	1.0 ug DNA	EUR 154

Pth2r sgRNA CRISPR Lentivector (Rat) (Target 3)
K7009004	ABM	1.0 ug DNA	EUR 154

PTH2R Protein Vector (Human) (pPB-C-His)
PV033509	ABM	500 ng	EUR 329

PTH2R Protein Vector (Human) (pPB-N-His)
PV033510	ABM	500 ng	EUR 329

PTH2R Protein Vector (Human) (pPM-C-HA)
PV033511	ABM	500 ng	EUR 329

PTH2R Protein Vector (Human) (pPM-C-His)
PV033512	ABM	500 ng	EUR 329

PTH2R Protein Vector (Rat) (pPB-C-His)
PV297146	ABM	500 ng	EUR 603

PTH2R Protein Vector (Rat) (pPB-N-His)
PV297147	ABM	500 ng	EUR 603

PTH2R Protein Vector (Rat) (pPM-C-HA)
PV297148	ABM	500 ng	EUR 603

PTH2R Protein Vector (Rat) (pPM-C-His)
PV297149	ABM	500 ng	EUR 603

PTH2R Protein Vector (Mouse) (pPB-C-His)
PV220738	ABM	500 ng	EUR 603

PTH2R Protein Vector (Mouse) (pPB-N-His)
PV220739	ABM	500 ng	EUR 603

PTH2R Protein Vector (Mouse) (pPM-C-HA)
PV220740	ABM	500 ng	EUR 603

PTH2R Protein Vector (Mouse) (pPM-C-His)
PV220741	ABM	500 ng	EUR 603

Pth2r 3'UTR GFP Stable Cell Line
TU167250	ABM	1.0 ml	Ask for price

PTH2R 3'UTR Luciferase Stable Cell Line
TU019165	ABM	1.0 ml	EUR 1394

Pth2r 3'UTR Luciferase Stable Cell Line
TU117250	ABM	1.0 ml	Ask for price

PTH2R 3'UTR GFP Stable Cell Line
TU069165	ABM	1.0 ml	EUR 1394

Pth2r 3'UTR GFP Stable Cell Line
TU267043	ABM	1.0 ml	Ask for price

Pth2r 3'UTR Luciferase Stable Cell Line
TU217043	ABM	1.0 ml	Ask for price

Rat Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
abx570112-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Pig Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
abx360916-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human PTH2R/ Parathyroid hormone 2 receptor ELISA Kit
E2943Hu	Sunlong	1 Kit	EUR 605

Human Parathyroid hormone 2 receptor, PTH2R ELISA KIT
ELI-14038h	Lifescience Market	96 Tests	EUR 824

Mouse Parathyroid hormone 2 receptor, Pth2r ELISA KIT
ELI-15072m	Lifescience Market	96 Tests	EUR 865

Human Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
20-abx152888	Abbexa	EUR 6642.00 EUR 3542.00 EUR 825.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
abx351758-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Mouse Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
abx352930-96tests	Abbexa	96 tests	EUR 668
Shipped within 5-12 working days.

Chicken Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
abx356299-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Monkey Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
abx359343-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rat Parathyroid Hormone Receptor 2 (PTH2R) ELISA Kit
abx255963-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

PTH2R Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV652525	ABM	1.0 ug DNA	EUR 682

PTH2R Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV652529	ABM	1.0 ug DNA	EUR 682

PTH2R Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV652530	ABM	1.0 ug DNA	EUR 682

VEGF Rabbit Polyclonal Antibody
ES8453-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

PTH2R Rabbit Polyclonal Antibody