BRD2 Rabbit Polyclonal Antibody

BRD2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    BRD2 Polyclonal Antibody
    ABP57923-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human BRD2 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of BRD2 from Human. This BRD2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human BRD2 protein
    BRD2 polyclonal antibody
    EUR 251
    Polyclonal BRD2 polyclonal antibody
    APR00374G 0.05ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:
    Polyclonal BRD2 polyclonal antibody
    APR00447G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 polyclonal . This antibody is tested and proven to work in the following applications:
    BRD2 Rabbit pAb
    A18229-100ul 100 ul
    EUR 308
    BRD2 Rabbit pAb
    A18229-200ul 200 ul
    EUR 459
    BRD2 Rabbit pAb
    A18229-20ul 20 ul
    EUR 183
    BRD2 Rabbit pAb
    A18229-50ul 50 ul
    EUR 223
    BRD2 Rabbit pAb
    A16241-100ul 100 ul
    EUR 308
    BRD2 Rabbit pAb
    A16241-200ul 200 ul
    EUR 459
    BRD2 Rabbit pAb
    A16241-20ul 20 ul
    EUR 183
    BRD2 Rabbit pAb
    A16241-50ul 50 ul
    EUR 223
    BRD2 Rabbit pAb
    A2233-100ul 100 ul
    EUR 308
    BRD2 Rabbit pAb
    A2233-200ul 200 ul
    EUR 459
    BRD2 Rabbit pAb
    A2233-20ul 20 ul Ask for price
    BRD2 Rabbit pAb
    A2233-50ul 50 ul Ask for price
    Polyclonal BRD2 Antibody (Center)
    APR06057G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 (Center). This antibody is tested and proven to work in the following applications:
    BRD2 Antibody
    49970-100ul 100ul
    EUR 333
    BRD2 Antibody
    49970-50ul 50ul
    EUR 239
    BRD2 Antibody
    EUR 349
    BRD2 Antibody
    EUR 146
    BRD2 Antibody
    DF12857 200ul
    EUR 304
    Description: BRD2 Antibody detects endogenous levels of BRD2.
    Polyclonal BRD2 antibody - C-terminal region
    APR00570G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human BRD2 - C-terminal region. This antibody is tested and proven to work in the following applications:
    BRD2 Conjugated Antibody
    C49970 100ul
    EUR 397
    anti- BRD2 antibody
    FNab00946 100µg
    EUR 505.25
    • Recommended dilution: WB: 1:500-1:1000
    • IP: 1:200-1:1000
    • Immunogen: bromodomain containing 2
    • Uniprot ID: P25440
    • Gene ID: 6046
    • Research Area: Metabolism, Developmental biology
    Description: Antibody raised against BRD2
    Anti-BRD2 antibody
    PAab00946 100 ug
    EUR 355
    Anti-BRD2 antibody
    STJ29878 100 µl
    EUR 277
    Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene.
    Anti-BRD2 antibody
    STJ11100186 100 µl
    EUR 277
    Description: This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene.
    Anti-BRD2 antibody
    STJ118693 100 µl
    EUR 277
    Anti-BRD2 antibody
    STJ192932 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to BRD2
    BRD2 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    BRD2 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    BRD2 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    YF-PA14402 50 ug
    EUR 363
    Description: Mouse polyclonal to BRD2
    YF-PA14403 100 ul
    EUR 403
    Description: Rabbit polyclonal to BRD2
    YF-PA24585 50 ul
    EUR 334
    Description: Mouse polyclonal to BRD2
    BRD2 cloning plasmid
    CSB-CL002800HU-10ug 10ug
    EUR 812
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2511
    • Sequence: atgctgcaaaacgtgactccccacaataagctccctggggaagggaatgcagggttgctggggctgggcccagaagcagcagcaccagggaaaaggattcgaaaaccctctctcttgtatgagggctttgagagccccacaatggcttcggtgcctgctttgcaacttacccctg
    • Show more
    Description: A cloning plasmid for the BRD2 gene.
    BRD2 Blocking Peptide
    EUR 153
    BRD2 Blocking Peptide
    DF12857-BP 1mg
    EUR 195
    Anti-BRD2 (3D10)
    YF-MA10786 100 ug
    EUR 363
    Description: Mouse monoclonal to BRD2
    Antibody for Human BRD2 (pSer37)
    SPC-925D 0.1ml
    EUR 354
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is unconjugated.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-A390 0.1ml
    EUR 401
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 390.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-A488 0.1ml
    EUR 400
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 488.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-A565 0.1ml
    EUR 400
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 565.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-A594 0.1ml
    EUR 400
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 594.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-A633 0.1ml
    EUR 400
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 633.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-A655 0.1ml
    EUR 400
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 655.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-A680 0.1ml
    EUR 400
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 680.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-A700 0.1ml
    EUR 400
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to ATTO 700.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-ALP 0.1ml
    EUR 394
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Alkaline Phosphatase.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-APC 0.1ml
    EUR 399
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC .
    Antibody for Human BRD2 (pSer37)
    SPC-925D-APCCY7 0.1ml
    EUR 471
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to APC/Cy7.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-BI 0.1ml
    EUR 396
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Biotin.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-DY350 0.1ml
    EUR 475
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 350.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-DY405 0.1ml
    EUR 452
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 405.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-DY488 0.1ml
    EUR 432
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 488.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-DY594 0.1ml
    EUR 436
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 594.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-DY633 0.1ml
    EUR 426
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Dylight 633.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-FITC 0.1ml
    EUR 392
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to FITC.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-HRP 0.1ml
    EUR 388
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to HRP.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-P594 0.1ml
    EUR 407
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PE/ATTO 594.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-PCP 0.1ml
    EUR 399
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to PerCP.
    Antibody for Human BRD2 (pSer37)
    SPC-925D-RPE 0.1ml
    EUR 397
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to RPE .
    Antibody for Human BRD2 (pSer37)
    SPC-925D-STR 0.1ml
    EUR 398
    • The bromodomain-containing proteins include BRD2, BRD3, BRD4 and BRDT. BRD2 (RING3 protein) is a mitogen-activated nuclear protein whose gene is located in the human MHC II region, suggesting its relation to HLA-associated diseases.
    Description: A polyclonal antibody for BRD2 (pSer37) from Human. The antibody is produced in rabbit after immunization with Human A phospho-specific peptide corresponding to residues surrounding Ser37 of human BRD2 (AA34-40). The Antibody is tested and validated for WB, AM assays with the following recommended dilutions: WB (1:250). This BRD2 (pSer37) antibody is conjugated to Streptavidin.
    Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
    E04B0834-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
    E04B0834-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Rabbit Bromodomain containing protein 2(BRD2) ELISA kit
    E04B0834-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Bromodomain containing protein 2(BRD2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.
    Bromodomain-Containing Protein 2 (BRD2) Antibody
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.
    Bromodomain-Containing Protein 2 (BRD2) Antibody
    abx145199-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Bromodomain-Containing Protein 2 (BRD2) Antibody
    abx033841-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Bromodomain-Containing Protein 2 (BRD2) Antibody
    abx033841-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Bromodomain-Containing Protein 2 (BRD2) Antibody
    abx224363-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.
    Bromodomain-Containing Protein 2 (BRD2) Antibody
    abx224465-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.
    Bromodomain-Containing Protein 2 (BRD2) Antibody
    abx230946-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Rat BRD2 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    BRD2 ELISA KIT|Human
    EF008143 96 Tests
    EUR 689
    Human BRD2 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    BRD2 protein (His tag)
    80R-4011 100 ug
    EUR 349
    Description: Recombinant Human BRD2 protein
    Mouse BRD2 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    pCMV-SPORT6-BRD2 Plasmid
    PVTB00811 2 ug
    EUR 356
    BRD2 ORF Vector (Human) (pORF)
    ORF001061 1.0 ug DNA
    EUR 95
    Brd2 ORF Vector (Mouse) (pORF)
    ORF039956 1.0 ug DNA
    EUR 506
    Brd2 ORF Vector (Mouse) (pORF)
    ORF039957 1.0 ug DNA
    EUR 506
    Brd2 ORF Vector (Rat) (pORF)
    ORF064136 1.0 ug DNA
    EUR 506
    BRD2 sgRNA CRISPR Lentivector set (Human)
    K0194001 3 x 1.0 ug
    EUR 339
    Brd2 sgRNA CRISPR Lentivector set (Mouse)
    K4674101 3 x 1.0 ug
    EUR 339
    Brd2 sgRNA CRISPR Lentivector set (Rat)
    K7291101 3 x 1.0 ug
    EUR 339
    BRD2-IT1 ORF Vector (Human) (pORF)
    ORF016242 1.0 ug DNA Ask for price
    Recombinant Bromodomain Containing Protein 2 (BRD2)
    • EUR 332.96
    • EUR 192.00
    • EUR 973.60
    • EUR 391.20
    • EUR 682.40
    • EUR 286.00
    • EUR 2284.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P25440
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 30.6kDa
    • Isoelectric Point: 9.3
    Description: Recombinant Human Bromodomain Containing Protein 2 expressed in: E.coli
    Human Bromodomain-Containing Protein 2 (BRD2) Protein
    • EUR 481.00
    • EUR 230.00
    • EUR 1330.00
    • EUR 551.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    BRD2 sgRNA CRISPR Lentivector (Human) (Target 1)
    K0194002 1.0 ug DNA
    EUR 154
    BRD2 sgRNA CRISPR Lentivector (Human) (Target 2)
    K0194003 1.0 ug DNA
    EUR 154
    BRD2 sgRNA CRISPR Lentivector (Human) (Target 3)
    K0194004 1.0 ug DNA
    EUR 154
    Brd2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4674102 1.0 ug DNA
    EUR 154
    Brd2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4674103 1.0 ug DNA
    EUR 154
    Brd2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4674104 1.0 ug DNA
    EUR 154
    Brd2 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7291102 1.0 ug DNA
    EUR 154
    Brd2 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7291103 1.0 ug DNA
    EUR 154
    Brd2 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7291104 1.0 ug DNA
    EUR 154
    BRD2 Bromodomain Containing 2 Human Recombinant Protein
    PROTP25440 Regular: 20ug
    EUR 317
    Description: BRD2 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 478 amino acids (1-455 a.a) and having a molecular mass of 52.8kDa. BRD2 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    Recombinant Human BRD2 Protein, His, E.coli-1mg
    QP11203-1mg 1mg
    EUR 2757
    Recombinant Human BRD2 Protein, His, E.coli-20ug
    QP11203-20ug 20ug
    EUR 201
    Recombinant Human BRD2 Protein, His, E.coli-5ug
    QP11203-5ug 5ug
    EUR 155
    BRD2 Protein Vector (Human) (pPB-C-His)
    PV004241 500 ng
    EUR 329
    BRD2 Protein Vector (Human) (pPB-N-His)
    PV004242 500 ng
    EUR 329
    BRD2 Protein Vector (Human) (pPM-C-HA)
    PV004243 500 ng
    EUR 329
    BRD2 Protein Vector (Human) (pPM-C-His)
    PV004244 500 ng
    EUR 329
    BRD2 Protein Vector (Human) (pPB-His-MBP)
    PV327458 500 ng
    EUR 329

    BRD2 Rabbit Polyclonal Antibody