ESM1 Rabbit Polyclonal Antibody
Contact Us Below To Order :
 ESM1 Polyclonal Antibody |
|
ABP58504-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human ESM1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein |
ESM1 Polyclonal Antibody |
|
ABP58504-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human ESM1 protein
- Applications tips:
|
|
Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein |
ESM1 Polyclonal Antibody |
|
ES11806-100ul |
ELK Biotech |
100ul |
EUR 279 |
|
Description: A Rabbit Polyclonal antibody against ESM1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
ESM1 Polyclonal Antibody |
|
ES11806-50ul |
ELK Biotech |
50ul |
EUR 207 |
|
Description: A Rabbit Polyclonal antibody against ESM1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA |
 ELISA Kit) Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit |
|
DLR-ESM1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Specific Molecule 1 (ESM1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit |
|
DLR-ESM1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Specific Molecule 1 (ESM1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit |
|
RDR-ESM1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit |
|
RDR-ESM1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit |
|
RD-ESM1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit |
|
RD-ESM1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
 ESM1 Polyclonal Antibody, Biotin Conjugated |
|
A58963 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: reagents widely cited |
 ESM1 Polyclonal Antibody, FITC Conjugated |
|
A58964 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: Ask the seller for details |
 ESM1 Polyclonal Antibody, HRP Conjugated |
|
A58965 |
EpiGentek |
100 µg |
EUR 570.55 |
|
Description: The best epigenetics products |
 ESM1 Antibody |
|
47244-100ul |
SAB |
100ul |
EUR 252 |
ESM1 Antibody |
|
1-CSB-PA007825HA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
ESM1 Antibody |
|
1-CSB-PA007825LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500 |
 Human ESM1 Antibody |
|
33408-05111 |
AssayPro |
150 ug |
EUR 261 |
 Anti-ESM1 Antibody |
|
A04169-1 |
BosterBio |
100ug/vial |
EUR 294 |
 ESM1 Conjugated Antibody |
|
C47244 |
SAB |
100ul |
EUR 397 |
 Anti-ESM1 antibody |
|
STJ192964 |
St John's Laboratory |
200 µl |
EUR 197 |
|
Description: Unconjugated Rabbit polyclonal to ESM1 |
 ESM1 siRNA |
|
20-abx901779 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ESM1 siRNA |
|
20-abx915688 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
ESM1 siRNA |
|
20-abx915689 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-ESM1 |
|
YF-PA17423 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to ESM1 |
anti-ESM1 |
|
YF-PA17424 |
Abfrontier |
100 ul |
EUR 403 |
|
Description: Rabbit polyclonal to ESM1 |
anti-ESM1 |
|
YF-PA17425 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to ESM1 |
anti-ESM1 |
|
YF-PA25731 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to ESM1 |
 ESM1 Antibody, HRP conjugated |
|
1-CSB-PA007825HB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
 ESM1 Antibody, FITC conjugated |
|
1-CSB-PA007825HC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
 ESM1 Antibody, Biotin conjugated |
|
1-CSB-PA007825HD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
ESM1 Antibody, HRP conjugated |
|
1-CSB-PA007825LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
ESM1 Antibody, FITC conjugated |
|
1-CSB-PA007825LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
ESM1 Antibody, Biotin conjugated |
|
1-CSB-PA007825LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
|
|
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
 ESM1 cloning plasmid |
|
CSB-CL007825HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 555
- Sequence: atgaagagcgtcttgctgctgaccacgctcctcgtgcctgcacacctggtggccgcctggagcaataattatgcggtggactgccctcaacactgtgacagcagtgagtgcaaaagcagcccgcgctgcgagaggacagtgctcgacgactgtggctgctgccgagtgtgcgctgc
- Show more
|
|
Description: A cloning plasmid for the ESM1 gene. |
) Anti-ESM1 (6D4) |
|
YF-MA11340 |
Abfrontier |
100 ug |
EUR 363 |
|
Description: Mouse monoclonal to ESM1 |
) Human ESM1 Antibody (Biotin Conjugate) |
|
33408-05121 |
AssayPro |
150 ug |
EUR 369 |
 Polyclonal Antibody (Human)) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human) |
|
4-PAC463Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Trp20~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1) |
 Polyclonal Antibody (Mouse)) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse) |
|
4-PAC463Mu01 |
Cloud-Clone |
-
EUR 251.00
-
EUR 2576.00
-
EUR 640.00
-
EUR 316.00
-
EUR 215.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1) |
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse) |
|
4-PAC463Mu02 |
Cloud-Clone |
-
EUR 243.00
-
EUR 2457.00
-
EUR 613.00
-
EUR 305.00
-
EUR 212.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1) |
 Polyclonal Antibody (Rat)) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat) |
|
4-PAC463Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1) |
 Polyclonal Antibody (Human), APC) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), APC |
|
4-PAC463Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Trp20~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC. |
 Polyclonal Antibody (Human), Biotinylated) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), Biotinylated |
|
4-PAC463Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Trp20~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Human), Cy3) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), Cy3 |
|
4-PAC463Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Trp20~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Human), FITC) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), FITC |
|
4-PAC463Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Trp20~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Human), HRP) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), HRP |
|
4-PAC463Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Trp20~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Human), PE) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), PE |
|
4-PAC463Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Trp20~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE. |
 Polyclonal Antibody (Mouse), APC) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC |
|
4-PAC463Mu01-APC |
Cloud-Clone |
-
EUR 351.00
-
EUR 3365.00
-
EUR 935.00
-
EUR 449.00
-
EUR 222.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC. |
 Polyclonal Antibody (Mouse), Biotinylated) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Biotinylated |
|
4-PAC463Mu01-Biotin |
Cloud-Clone |
-
EUR 316.00
-
EUR 2526.00
-
EUR 744.00
-
EUR 387.00
-
EUR 221.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Mouse), Cy3) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Cy3 |
|
4-PAC463Mu01-Cy3 |
Cloud-Clone |
-
EUR 427.00
-
EUR 4445.00
-
EUR 1205.00
-
EUR 557.00
-
EUR 254.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Mouse), FITC) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), FITC |
|
4-PAC463Mu01-FITC |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Mouse), HRP) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), HRP |
|
4-PAC463Mu01-HRP |
Cloud-Clone |
-
EUR 321.00
-
EUR 2933.00
-
EUR 827.00
-
EUR 405.00
-
EUR 209.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Mouse), PE) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), PE |
|
4-PAC463Mu01-PE |
Cloud-Clone |
-
EUR 301.00
-
EUR 2712.00
-
EUR 768.00
-
EUR 379.00
-
EUR 197.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE. |
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC |
|
4-PAC463Mu02-APC |
Cloud-Clone |
-
EUR 340.00
-
EUR 3203.00
-
EUR 894.00
-
EUR 432.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC. |
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Biotinylated |
|
4-PAC463Mu02-Biotin |
Cloud-Clone |
-
EUR 307.00
-
EUR 2407.00
-
EUR 714.00
-
EUR 375.00
-
EUR 217.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin. |
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Cy3 |
|
4-PAC463Mu02-Cy3 |
Cloud-Clone |
-
EUR 411.00
-
EUR 4229.00
-
EUR 1151.00
-
EUR 535.00
-
EUR 248.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3. |
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), FITC |
|
4-PAC463Mu02-FITC |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC. |
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), HRP |
|
4-PAC463Mu02-HRP |
Cloud-Clone |
-
EUR 311.00
-
EUR 2792.00
-
EUR 791.00
-
EUR 391.00
-
EUR 205.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP. |
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), PE |
|
4-PAC463Mu02-PE |
Cloud-Clone |
-
EUR 292.00
-
EUR 2582.00
-
EUR 735.00
-
EUR 366.00
-
EUR 194.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE. |
 Polyclonal Antibody (Rat), APC) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), APC |
|
4-PAC463Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC. |
 Polyclonal Antibody (Rat), Biotinylated) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), Biotinylated |
|
4-PAC463Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Rat), Cy3) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), Cy3 |
|
4-PAC463Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Rat), FITC) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), FITC |
|
4-PAC463Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC. |
 Polyclonal Antibody (Rat), HRP) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), HRP |
|
4-PAC463Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP. |
 Polyclonal Antibody (Rat), PE) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), PE |
|
4-PAC463Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE. |
) Human ESM1 AssayLite Antibody (FITC Conjugate) |
|
33408-05141 |
AssayPro |
150 ug |
EUR 428 |
) Human ESM1 AssayLite Antibody (RPE Conjugate) |
|
33408-05151 |
AssayPro |
150 ug |
EUR 428 |
) Human ESM1 AssayLite Antibody (APC Conjugate) |
|
33408-05161 |
AssayPro |
150 ug |
EUR 428 |
) Human ESM1 AssayLite Antibody (PerCP Conjugate) |
|
33408-05171 |
AssayPro |
150 ug |
EUR 471 |
) ESM1 protein (His tag) |
|
30R-2928 |
Fitzgerald |
100 ug |
EUR 322 |
|
Description: Purified recombinant Human ESM1 protein (His tag) |
 Mouse ESM1 shRNA Plasmid |
|
20-abx977459 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Rat ESM1 shRNA Plasmid |
|
20-abx986284 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
 Human ESM1 shRNA Plasmid |
|
20-abx957579 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) ESM1 Recombinant Protein (Human) |
|
RP010939 |
ABM |
100 ug |
Ask for price |
) ESM1 Recombinant Protein (Rat) |
|
RP199958 |
ABM |
100 ug |
Ask for price |
) ESM1 Recombinant Protein (Mouse) |
|
RP132248 |
ABM |
100 ug |
Ask for price |
 Human ESM1 ELISA Kit |
|
STJ150455 |
St John's Laboratory |
1 kit |
EUR 412 |
|
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ESM1 in human serum, plasma and other biological fluids |
 Polyclonal Antibody (Human), APC-Cy7) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), APC-Cy7 |
|
4-PAC463Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Trp20~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7. |
 Polyclonal Antibody (Mouse), APC-Cy7) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC-Cy7 |
|
4-PAC463Mu01-APC-Cy7 |
Cloud-Clone |
-
EUR 583.00
-
EUR 6610.00
-
EUR 1750.00
-
EUR 778.00
-
EUR 324.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7. |
Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC-Cy7 |
|
4-PAC463Mu02-APC-Cy7 |
Cloud-Clone |
-
EUR 560.00
-
EUR 6286.00
-
EUR 1669.00
-
EUR 745.00
-
EUR 315.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7. |
 Polyclonal Antibody (Rat), APC-Cy7) Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), APC-Cy7 |
|
4-PAC463Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: ESM1 (Ala22~Arg184)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7. |
 Antibody) Endothelial Cell Specific Molecule 1 (ESM1) Antibody |
|
20-abx103810 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1177.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelial Cell Specific Molecule 1 (ESM1) Antibody |
|
20-abx103811 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelial Cell Specific Molecule 1 (ESM1) Antibody |
|
20-abx103812 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelial Cell Specific Molecule 1 (ESM1) Antibody |
|
20-abx103813 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Endothelial Cell Specific Molecule 1 (ESM1) Antibody |
|
20-abx172232 |
Abbexa |
-
EUR 342.00
-
EUR 857.00
-
EUR 439.00
-
EUR 154.00
-
EUR 258.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
 Antibody) Endothelial Cell-Specific Molecule 1 (ESM1) Antibody |
|
20-abx301870 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Endothelial Cell-Specific Molecule 1 (ESM1) Antibody |
|
20-abx303756 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
 (M02), Clone: 6D4) Monoclonal ESM1 Antibody (monoclonal) (M02), Clone: 6D4 |
|
AMM03504G |
Leading Biology |
0.1mg |
EUR 484 |
|
Description: A Monoclonal antibody against Human ESM1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 6D4. This antibody is applicable in WB and IHC, E |
 Human ESM1 AssayMax ELISA Kit |
|
EE3520-1 |
AssayPro |
96 Well Plate |
EUR 477 |
 Human ESM1/Endocan ELISA Kit |
|
LF-EK50900 |
Abfrontier |
1×96T |
EUR 648 |
 Mouse ESM1/Endocan ELISA Kit |
|
LF-EK50901 |
Abfrontier |
1×96T |
EUR 648 |
 (pORF)) Esm1 ORF Vector (Rat) (pORF) |
|
ORF066654 |
ABM |
1.0 ug DNA |
EUR 506 |
 (pORF)) ESM1 ORF Vector (Human) (pORF) |
|
ORF003647 |
ABM |
1.0 ug DNA |
EUR 95 |
 (pORF)) Esm1 ORF Vector (Mouse) (pORF) |
|
ORF044084 |
ABM |
1.0 ug DNA |
EUR 506 |
 (OKCA02546)) ESM1 ELISA Kit (Rat) (OKCA02546) |
|
OKCA02546 |
Aviva Systems Biology |
96 Wells |
EUR 846 |
|
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.156 ng/mL |
 (OKCD08140)) ESM1 ELISA Kit (Human) (OKCD08140) |
|
OKCD08140 |
Aviva Systems Biology |
96 Wells |
EUR 975 |
|
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.2pg/mL |
ESM1 Rabbit Polyclonal Antibody
