ESM1 Rabbit Polyclonal Antibody

ESM1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

ESM1 Polyclonal Antibody
ABP58504-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human ESM1 protein Applications tips:
Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein

ESM1 Polyclonal Antibody
ABP58504-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human ESM1 protein Applications tips:
Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein

ESM1 Polyclonal Antibody
ES11806-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against ESM1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

ESM1 Polyclonal Antibody
ES11806-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against ESM1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
DLR-ESM1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Specific Molecule 1 (ESM1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
DLR-ESM1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Specific Molecule 1 (ESM1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
RDR-ESM1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
RDR-ESM1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
RD-ESM1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit
RD-ESM1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

ESM1 Polyclonal Antibody, Biotin Conjugated
A58963	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

ESM1 Polyclonal Antibody, FITC Conjugated
A58964	EpiGentek	100 µg	EUR 570.55
Description: Ask the seller for details

ESM1 Polyclonal Antibody, HRP Conjugated
A58965	EpiGentek	100 µg	EUR 570.55
Description: The best epigenetics products

ESM1 Antibody
47244-100ul	SAB	100ul	EUR 252

ESM1 Antibody
1-CSB-PA007825HA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

ESM1 Antibody
1-CSB-PA007825LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

Human ESM1 Antibody
33408-05111	AssayPro	150 ug	EUR 261

Anti-ESM1 Antibody
A04169-1	BosterBio	100ug/vial	EUR 294

ESM1 Conjugated Antibody
C47244	SAB	100ul	EUR 397

Anti-ESM1 antibody
STJ192964	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to ESM1

ESM1 siRNA
20-abx901779	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ESM1 siRNA
20-abx915688	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

ESM1 siRNA
20-abx915689	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

anti-ESM1
YF-PA17423	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to ESM1

anti-ESM1
YF-PA17424	Abfrontier	100 ul	EUR 403
Description: Rabbit polyclonal to ESM1

anti-ESM1
YF-PA17425	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to ESM1

anti-ESM1
YF-PA25731	Abfrontier	50 ul	EUR 334
Description: Mouse polyclonal to ESM1

ESM1 Antibody, HRP conjugated
1-CSB-PA007825HB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ESM1 Antibody, FITC conjugated
1-CSB-PA007825HC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ESM1 Antibody, Biotin conjugated
1-CSB-PA007825HD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ESM1 Antibody, HRP conjugated
1-CSB-PA007825LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

ESM1 Antibody, FITC conjugated
1-CSB-PA007825LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

ESM1 Antibody, Biotin conjugated
1-CSB-PA007825LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

ESM1 cloning plasmid
CSB-CL007825HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 555 Sequence: atgaagagcgtcttgctgctgaccacgctcctcgtgcctgcacacctggtggccgcctggagcaataattatgcggtggactgccctcaacactgtgacagcagtgagtgcaaaagcagcccgcgctgcgagaggacagtgctcgacgactgtggctgctgccgagtgtgcgctgc Show more
Description: A cloning plasmid for the ESM1 gene.

Anti-ESM1 (6D4)
YF-MA11340	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to ESM1

Human ESM1 Antibody (Biotin Conjugate)
33408-05121	AssayPro	150 ug	EUR 369

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human)
4-PAC463Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Trp20~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1)

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse)
4-PAC463Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1)

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse)
4-PAC463Mu02	Cloud-Clone	EUR 243.00 EUR 2457.00 EUR 613.00 EUR 305.00 EUR 212.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1)

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat)
4-PAC463Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1)

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), APC
4-PAC463Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Trp20~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), Biotinylated
4-PAC463Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Trp20~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), Cy3
4-PAC463Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Trp20~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), FITC
4-PAC463Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Trp20~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), HRP
4-PAC463Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Trp20~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), PE
4-PAC463Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Trp20~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC
4-PAC463Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC463Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Cy3
4-PAC463Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), FITC
4-PAC463Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), HRP
4-PAC463Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), PE
4-PAC463Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC
4-PAC463Mu02-APC	Cloud-Clone	EUR 340.00 EUR 3203.00 EUR 894.00 EUR 432.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC463Mu02-Biotin	Cloud-Clone	EUR 307.00 EUR 2407.00 EUR 714.00 EUR 375.00 EUR 217.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Cy3
4-PAC463Mu02-Cy3	Cloud-Clone	EUR 411.00 EUR 4229.00 EUR 1151.00 EUR 535.00 EUR 248.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), FITC
4-PAC463Mu02-FITC	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), HRP
4-PAC463Mu02-HRP	Cloud-Clone	EUR 311.00 EUR 2792.00 EUR 791.00 EUR 391.00 EUR 205.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), PE
4-PAC463Mu02-PE	Cloud-Clone	EUR 292.00 EUR 2582.00 EUR 735.00 EUR 366.00 EUR 194.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), APC
4-PAC463Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), Biotinylated
4-PAC463Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), Cy3
4-PAC463Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), FITC
4-PAC463Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), HRP
4-PAC463Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), PE
4-PAC463Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.

Human ESM1 AssayLite Antibody (FITC Conjugate)
33408-05141	AssayPro	150 ug	EUR 428

Human ESM1 AssayLite Antibody (RPE Conjugate)
33408-05151	AssayPro	150 ug	EUR 428

Human ESM1 AssayLite Antibody (APC Conjugate)
33408-05161	AssayPro	150 ug	EUR 428

Human ESM1 AssayLite Antibody (PerCP Conjugate)
33408-05171	AssayPro	150 ug	EUR 471

ESM1 protein (His tag)
30R-2928	Fitzgerald	100 ug	EUR 322
Description: Purified recombinant Human ESM1 protein (His tag)

Human ESM1 ELISA Kit
ELA-E2112h	Lifescience Market	96 Tests	EUR 824

ESM1 ELISA KIT|Human
EF000099	Lifescience Market	96 Tests	EUR 689

Mouse ESM1 shRNA Plasmid
20-abx977459	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat ESM1 shRNA Plasmid
20-abx986284	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ESM1 shRNA Plasmid
20-abx957579	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

ESM1 Recombinant Protein (Human)
RP010939	ABM	100 ug	Ask for price

ESM1 Recombinant Protein (Rat)
RP199958	ABM	100 ug	Ask for price

ESM1 Recombinant Protein (Mouse)
RP132248	ABM	100 ug	Ask for price

Human ESM1 ELISA Kit
STJ150455	St John's Laboratory	1 kit	EUR 412
Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ESM1 in human serum, plasma and other biological fluids

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), APC-Cy7
4-PAC463Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Trp20~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC463Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC463Mu02-APC-Cy7	Cloud-Clone	EUR 560.00 EUR 6286.00 EUR 1669.00 EUR 745.00 EUR 315.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.

Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), APC-Cy7
4-PAC463Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: ESM1 (Ala22~Arg184) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.

Endothelial Cell Specific Molecule 1 (ESM1) Antibody
20-abx103810	Abbexa	EUR 425.00 EUR 133.00 EUR 1177.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Endothelial Cell Specific Molecule 1 (ESM1) Antibody
20-abx103811	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Endothelial Cell Specific Molecule 1 (ESM1) Antibody
20-abx103812	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Endothelial Cell Specific Molecule 1 (ESM1) Antibody
20-abx103813	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Endothelial Cell Specific Molecule 1 (ESM1) Antibody
20-abx172232	Abbexa	EUR 342.00 EUR 857.00 EUR 439.00 EUR 154.00 EUR 258.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-12 working days.

Endothelial Cell-Specific Molecule 1 (ESM1) Antibody
20-abx301870	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Endothelial Cell-Specific Molecule 1 (ESM1) Antibody
20-abx303756	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Monoclonal ESM1 Antibody (monoclonal) (M02), Clone: 6D4
AMM03504G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human ESM1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 6D4. This antibody is applicable in WB and IHC, E

Human ESM1 AssayMax ELISA Kit
EE3520-1	AssayPro	96 Well Plate	EUR 477

Human ESM1/Endocan ELISA Kit
LF-EK50900	Abfrontier	1×96T	EUR 648

Mouse ESM1/Endocan ELISA Kit
LF-EK50901	Abfrontier	1×96T	EUR 648

Esm1 ORF Vector (Rat) (pORF)
ORF066654	ABM	1.0 ug DNA	EUR 506

ESM1 ORF Vector (Human) (pORF)
ORF003647	ABM	1.0 ug DNA	EUR 95

Esm1 ORF Vector (Mouse) (pORF)
ORF044084	ABM	1.0 ug DNA	EUR 506

ESM1 ELISA Kit (Rat) (OKCA02546)
OKCA02546	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.156 ng/mL

ESM1 ELISA Kit (Human) (OKCD08140)
OKCD08140	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.2pg/mL

ESM1 ELISA Kit (Rat) (OKEH06056)
OKEH06056	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.71 pg/mL

ESM1 ELISA Kit (Mouse) (OKEH06959)
OKEH06959	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 8.02 pg/mL

Endothelial Cell Specific Molecule 1 (ESM1) Antibody (Biotin)
20-abx272273	Abbexa	EUR 453.00 EUR 244.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Endothelial Cell Specific Molecule 1 (ESM1) Antibody (Biotin)
20-abx273372	Abbexa	EUR 481.00 EUR 244.00 EUR 1414.00 EUR 662.00 EUR 356.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (HRP)
20-abx316860	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (FITC)
20-abx316861	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (Biotin)
20-abx316862	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (HRP)
20-abx303757	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (FITC)
20-abx303758	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (Biotin)
20-abx303759	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

ELISA kit for Human ESM1/Endocan
EK5318	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Human ESM1/Endocan in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Mouse ESM1/Endocan
EK5319	SAB	96 tests	EUR 553
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse ESM1/Endocan in samples from serum, plasma, tissue homogenates and other biological fluids.

Human ESM1/Endocan PicoKine ELISA Kit
EK0752	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human ESM1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

Mouse ESM1/Endocan PicoKine ELISA Kit
EK0753	BosterBio	96 wells	EUR 425
Description: For quantitative detection of mouse ESM1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

ESM1 sgRNA CRISPR Lentivector set (Human)
K0696601	ABM	3 x 1.0 ug	EUR 339

Esm1 sgRNA CRISPR Lentivector set (Rat)
K6942301	ABM	3 x 1.0 ug	EUR 339

Esm1 sgRNA CRISPR Lentivector set (Mouse)
K3500801	ABM	3 x 1.0 ug	EUR 339

ESM1/Endocan ELISA Kit (Human) (OKBB00371)
OKBB00371	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Endothelial cell-specific molecule 1, also known as Endocan, is a protein that in humans is encoded by the ESM1 gene. This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. ESM1 has been described as a specific biomarker of tip cells during neoangiogenesis by independent teams. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF (vascular endothelial growth factor) or FGF-2 (fibroblast growth factor 2).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

ESM1/Endocan ELISA Kit (Mouse) (OKBB00372)
OKBB00372	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Endothelial cell-specific molecule 1, also known as Endocan, is a protein that in humans is encoded by the ESM1 gene. This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. ESM-1 has been described as a specific biomarker of tip cells during neoangiogenesis by independent teams. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF (vascular endothelial growth factor) or FGF-2 (fibroblast growth factor 2).;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

Mouse Endothelial cell-specific molecule 1 (Esm1)
1-CSB-EP007825MO	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 33.7 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Mouse Endothelial cell-specific molecule 1(Esm1) expressed in E.coli

Active Endothelial Cell Specific Molecule 1 (ESM1)
4-APC463Hu01	Cloud-Clone	EUR 794.40 EUR 316.00 EUR 2704.00 EUR 968.00 EUR 1836.00 EUR 595.00 EUR 6610.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9NQ30 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.4kDa Isoelectric Point: 6.7
Description: Recombinant Human Endothelial Cell Specific Molecule 1 expressed in: E.coli

Endothelial Cell-Specific Molecule 1 (ESM1) Protein
20-abx261000	Abbexa	EUR 3418.00 EUR 328.00 EUR 230.00	1 mg 20 ug 5 ug
Shipped within 5-10 working days.

ESM1 sgRNA CRISPR Lentivector (Human) (Target 1)
K0696602	ABM	1.0 ug DNA	EUR 154

ESM1 sgRNA CRISPR Lentivector (Human) (Target 2)
K0696603	ABM	1.0 ug DNA	EUR 154

ESM1 sgRNA CRISPR Lentivector (Human) (Target 3)
K0696604	ABM	1.0 ug DNA	EUR 154

Esm1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6942302	ABM	1.0 ug DNA	EUR 154

Esm1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6942303	ABM	1.0 ug DNA	EUR 154

Esm1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6942304	ABM	1.0 ug DNA	EUR 154

Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3500802	ABM	1.0 ug DNA	EUR 154

Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3500803	ABM	1.0 ug DNA	EUR 154

Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3500804	ABM	1.0 ug DNA	EUR 154

ESM1 Protein Vector (Mouse) (pPB-C-His)
PV176334	ABM	500 ng	EUR 603

ESM1 Protein Vector (Mouse) (pPB-N-His)
PV176335	ABM	500 ng	EUR 603

ESM1 Protein Vector (Mouse) (pPM-C-HA)
PV176336	ABM	500 ng	EUR 603

ESM1 Protein Vector (Mouse) (pPM-C-His)
PV176337	ABM	500 ng	EUR 603

ESM1 Protein Vector (Rat) (pPB-C-His)
PV266614	ABM	500 ng	EUR 603

ESM1 Protein Vector (Rat) (pPB-N-His)
PV266615	ABM	500 ng	EUR 603

ESM1 Protein Vector (Rat) (pPM-C-HA)
PV266616	ABM	500 ng	EUR 603

ESM1 Protein Vector (Rat) (pPM-C-His)
PV266617	ABM	500 ng	EUR 603

ESM1 Protein Vector (Human) (pPB-C-His)
PV014585	ABM	500 ng	EUR 329

ESM1 Protein Vector (Human) (pPB-N-His)
PV014586	ABM	500 ng	EUR 329

ESM1 Protein Vector (Human) (pPM-C-HA)
PV014587	ABM	500 ng	EUR 329

ESM1 Protein Vector (Human) (pPM-C-His)
PV014588	ABM	500 ng	EUR 329

Recombinant Endothelial Cell Specific Molecule 1 (ESM1)
4-RPC463Hu01	Cloud-Clone	EUR 377.76 EUR 204.00 EUR 1141.60 EUR 447.20 EUR 794.40 EUR 316.00 EUR 2704.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9NQ30 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.6kDa Isoelectric Point: Inquire
Description: Recombinant Human Endothelial Cell Specific Molecule 1 expressed in: E.coli

Recombinant Endothelial Cell Specific Molecule 1 (ESM1)
4-RPC463Mu01	Cloud-Clone	EUR 427.94 EUR 217.00 EUR 1329.76 EUR 509.92 EUR 919.84 EUR 349.00 EUR 3174.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QYY7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 67.7kDa Isoelectric Point: 5.4
Description: Recombinant Mouse Endothelial Cell Specific Molecule 1 expressed in: E.coli

Recombinant Endothelial Cell Specific Molecule 1 (ESM1)
4-RPC463Mu02	Cloud-Clone	EUR 427.94 EUR 217.00 EUR 1329.76 EUR 509.92 EUR 919.84 EUR 349.00 EUR 3174.40	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9QYY7 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 49.7kDa Isoelectric Point: 5.8
Description: Recombinant Mouse Endothelial Cell Specific Molecule 1 expressed in: E.coli

Recombinant Endothelial Cell Specific Molecule 1 (ESM1)
4-RPC463Ra01	Cloud-Clone	EUR 447.65 EUR 223.00 EUR 1403.68 EUR 534.56 EUR 969.12 EUR 362.00 EUR 3359.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P97682 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 19.3kDa Isoelectric Point: 5.7
Description: Recombinant Rat Endothelial Cell Specific Molecule 1 expressed in: E.coli

Recombinant Human ESM1 Protein, His, E.coli-10ug
QP11810-HIS-10ug	EnQuireBio	10ug	EUR 201

Recombinant Human ESM1 Protein, His, E.coli-20ug
QP11810-HIS-20ug	EnQuireBio	20ug	EUR 201

Recombinant Human ESM1 Protein, His, E.coli-2ug
QP11810-HIS-2ug	EnQuireBio	2ug	EUR 155

Recombinant Human ESM1 Protein, His, E.coli-5ug
QP11810-HIS-5ug	EnQuireBio	5ug	EUR 155

Recombinant Human ESM1 Protein, His, E.coli-1mg
QP11810-HIS-EC-1mg	EnQuireBio	1mg	EUR 2757

Esm1 3'UTR GFP Stable Cell Line
TU155951	ABM	1.0 ml	Ask for price

Esm1 3'UTR Luciferase Stable Cell Line
TU105951	ABM	1.0 ml	Ask for price

Esm1 3'UTR Luciferase Stable Cell Line
TU204106	ABM	1.0 ml	Ask for price

Esm1 3'UTR GFP Stable Cell Line
TU254106	ABM	1.0 ml	Ask for price

ESM1 3'UTR GFP Stable Cell Line
TU057059	ABM	1.0 ml	EUR 1394

ESM1 3'UTR Luciferase Stable Cell Line
TU007059	ABM	1.0 ml	EUR 1394

ESM1 ELISA Kit (Human) : 96 Wells (OKEH02734)
OKEH02734	Aviva Systems Biology	96 Wells	EUR 662
Description: Description of target: This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. Two transcript variants encoding different isoforms have been found for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

mStrawberry Rabbit Polyclonal Antibody
38083-100ul	SAB	100ul	EUR 252

mStrawberry Rabbit Polyclonal Antibody
38083-50ul	SAB	50ul	EUR 187

AmCyan Rabbit Polyclonal Antibody
38086-100ul	SAB	100ul	EUR 252

ESM1 Rabbit Polyclonal Antibody