ESM1 Rabbit Polyclonal Antibody

ESM1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    ESM1 Polyclonal Antibody

    ABP58504-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human ESM1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein

    ESM1 Polyclonal Antibody

    ABP58504-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human ESM1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein

    ESM1 Polyclonal Antibody

    ABP58504-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human ESM1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of ESM1 from Human. This ESM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human ESM1 protein

    ESM1 Polyclonal Antibody

    A58962 100 µg
    EUR 570.55
    Description: fast delivery possible

    Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit

    DLR-ESM1-Hu-48T 48T
    EUR 517
    • Should the Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Specific Molecule 1 (ESM1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit

    DLR-ESM1-Hu-96T 96T
    EUR 673
    • Should the Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Endothelial Cell Specific Molecule 1 (ESM1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

    Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit

    RD-ESM1-Hu-48Tests 48 Tests
    EUR 521

    Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit

    RD-ESM1-Hu-96Tests 96 Tests
    EUR 723

    Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit

    RDR-ESM1-Hu-48Tests 48 Tests
    EUR 544

    Human Endothelial Cell Specific Molecule 1 (ESM1) ELISA Kit

    RDR-ESM1-Hu-96Tests 96 Tests
    EUR 756

    ESM1 Polyclonal Antibody, Biotin Conjugated

    A58963 100 µg
    EUR 570.55
    Description: reagents widely cited

    ESM1 Polyclonal Antibody, FITC Conjugated

    A58964 100 µg
    EUR 570.55
    Description: Ask the seller for details

    ESM1 Polyclonal Antibody, HRP Conjugated

    A58965 100 µg
    EUR 570.55
    Description: The best epigenetics products

    ESM1 Antibody

    47244-100ul 100ul
    EUR 252

    ESM1 Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    ESM1 Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:200-1:500

    ESM1 Conjugated Antibody

    C47244 100ul
    EUR 397

    Anti-ESM1 Antibody

    A04169-1 100ug/vial
    EUR 294

    Human ESM1 Antibody

    33408-05111 150 ug
    EUR 261

    Anti-ESM1 antibody

    STJ192964 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to ESM1

    ESM1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ESM1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    ESM1 siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.


    YF-PA17423 50 ug
    EUR 363
    Description: Mouse polyclonal to ESM1


    YF-PA17424 100 ul
    EUR 403
    Description: Rabbit polyclonal to ESM1


    YF-PA17425 100 ug
    EUR 403
    Description: Rabbit polyclonal to ESM1


    YF-PA25731 50 ul
    EUR 334
    Description: Mouse polyclonal to ESM1

    ESM1 Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    ESM1 Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    ESM1 Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    ESM1 Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    ESM1 Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    ESM1 Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against ESM1. Recognizes ESM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    ESM1 cloning plasmid

    CSB-CL007825HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 555
    • Sequence: atgaagagcgtcttgctgctgaccacgctcctcgtgcctgcacacctggtggccgcctggagcaataattatgcggtggactgccctcaacactgtgacagcagtgagtgcaaaagcagcccgcgctgcgagaggacagtgctcgacgactgtggctgctgccgagtgtgcgctgc
    • Show more
    Description: A cloning plasmid for the ESM1 gene.

    Anti-ESM1 (6D4)

    YF-MA11340 100 ug
    EUR 363
    Description: Mouse monoclonal to ESM1

    Human ESM1 Antibody (Biotin Conjugate)

    33408-05121 150 ug
    EUR 369

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human)

    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Trp20~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1)

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse)

    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1)

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse)

    • EUR 243.00
    • EUR 2457.00
    • EUR 613.00
    • EUR 305.00
    • EUR 212.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1)

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat)

    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1)

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), APC

    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Trp20~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), Biotinylated

    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Trp20~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), Cy3

    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Trp20~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), FITC

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Trp20~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), HRP

    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Trp20~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), PE

    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Trp20~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC

    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Biotinylated

    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Cy3

    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), FITC

    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), HRP

    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), PE

    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC

    • EUR 340.00
    • EUR 3203.00
    • EUR 894.00
    • EUR 432.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Biotinylated

    • EUR 307.00
    • EUR 2407.00
    • EUR 714.00
    • EUR 375.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), Cy3

    • EUR 411.00
    • EUR 4229.00
    • EUR 1151.00
    • EUR 535.00
    • EUR 248.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), FITC

    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), HRP

    • EUR 311.00
    • EUR 2792.00
    • EUR 791.00
    • EUR 391.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), PE

    • EUR 292.00
    • EUR 2582.00
    • EUR 735.00
    • EUR 366.00
    • EUR 194.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), APC

    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), Biotinylated

    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Biotin.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), Cy3

    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with Cy3.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), FITC

    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with FITC.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), HRP

    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with HRP.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), PE

    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with PE.

    Human ESM1 AssayLite Antibody (FITC Conjugate)

    33408-05141 150 ug
    EUR 428

    Human ESM1 AssayLite Antibody (RPE Conjugate)

    33408-05151 150 ug
    EUR 428

    Human ESM1 AssayLite Antibody (APC Conjugate)

    33408-05161 150 ug
    EUR 428

    Human ESM1 AssayLite Antibody (PerCP Conjugate)

    33408-05171 150 ug
    EUR 471

    Mouse ESM1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat ESM1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human ESM1 ELISA Kit

    ELA-E2112h 96 Tests
    EUR 824

    ESM1 ELISA KIT|Human

    EF000099 96 Tests
    EUR 689

    Human ESM1 shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    ESM1 protein (His tag)

    30R-2928 100 ug
    EUR 322
    Description: Purified recombinant Human ESM1 protein (His tag)

    ESM1 Recombinant Protein (Human)

    RP010939 100 ug Ask for price

    ESM1 Recombinant Protein (Rat)

    RP199958 100 ug Ask for price

    ESM1 Recombinant Protein (Mouse)

    RP132248 100 ug Ask for price

    Human ESM1 ELISA Kit

    STJ150455 1 kit
    EUR 412
    Description: The kit is a sandwich enzyme immunoassay for in vitro quantitative measurement of ESM1 in human serum, plasma and other biological fluids

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Human), APC-Cy7

    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Trp20~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC-Cy7

    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Mouse), APC-Cy7

    • EUR 560.00
    • EUR 6286.00
    • EUR 1669.00
    • EUR 745.00
    • EUR 315.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.

    Endothelial Cell Specific Molecule 1 (ESM1) Polyclonal Antibody (Rat), APC-Cy7

    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: ESM1 (Ala22~Arg184)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Endothelial Cell Specific Molecule 1 (ESM1). This antibody is labeled with APC-Cy7.

    Monoclonal ESM1 Antibody (monoclonal) (M02), Clone: 6D4

    AMM03504G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human ESM1 (monoclonal) (M02). The antibodies are raised in mouse and are from clone 6D4. This antibody is applicable in WB and IHC, E

    Endothelial Cell Specific Molecule 1 (ESM1) Antibody

    • EUR 425.00
    • EUR 133.00
    • EUR 1177.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Endothelial Cell Specific Molecule 1 (ESM1) Antibody

    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Endothelial Cell Specific Molecule 1 (ESM1) Antibody

    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Endothelial Cell Specific Molecule 1 (ESM1) Antibody

    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Endothelial Cell Specific Molecule 1 (ESM1) Antibody

    • EUR 342.00
    • EUR 857.00
    • EUR 439.00
    • EUR 154.00
    • EUR 258.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Endothelial Cell-Specific Molecule 1 (ESM1) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Endothelial Cell-Specific Molecule 1 (ESM1) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Human ESM1 AssayMax ELISA Kit

    EE3520-1 96 Well Plate
    EUR 477

    ESM1 ORF Vector (Human) (pORF)

    ORF003647 1.0 ug DNA
    EUR 95

    Esm1 ORF Vector (Rat) (pORF)

    ORF066654 1.0 ug DNA
    EUR 506

    Human ESM1/Endocan ELISA Kit

    LF-EK50900 1×96T
    EUR 648

    Mouse ESM1/Endocan ELISA Kit

    LF-EK50901 1×96T
    EUR 648

    Esm1 ORF Vector (Mouse) (pORF)

    ORF044084 1.0 ug DNA
    EUR 506

    ESM1 ELISA Kit (Human) (OKCD08140)

    OKCD08140 96 Wells
    EUR 975
    Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 6.2pg/mL

    ESM1 ELISA Kit (Rat) (OKCA02546)

    OKCA02546 96 Wells
    EUR 846
    Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: 0.156 ng/mL

    ESM1 ELISA Kit (Rat) (OKEH06056)

    OKEH06056 96 Wells
    EUR 662
    Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.71 pg/mL

    ESM1 ELISA Kit (Mouse) (OKEH06959)

    OKEH06959 96 Wells
    EUR 662
    Description: Description of target: Involved in angiogenesis; promotes angiogenic sprouting. May have potent implications in lung endothelial cell-leukocyte interactions.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 8.02 pg/mL

    Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Endothelial Cell Specific Molecule 1 (ESM1) Antibody (Biotin)

    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Endothelial Cell Specific Molecule 1 (ESM1) Antibody (Biotin)

    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Endothelial Cell-Specific Molecule 1 (ESM1) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    ELISA kit for Human ESM1/Endocan

    EK5318 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Human ESM1/Endocan in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Mouse ESM1/Endocan

    EK5319 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse ESM1/Endocan in samples from serum, plasma, tissue homogenates and other biological fluids.

    Human ESM1/Endocan PicoKine ELISA Kit

    EK0752 96 wells
    EUR 425
    Description: For quantitative detection of human ESM1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

    Mouse ESM1/Endocan PicoKine ELISA Kit

    EK0753 96 wells
    EUR 425
    Description: For quantitative detection of mouse ESM1 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

    Esm1 sgRNA CRISPR Lentivector set (Mouse)

    K3500801 3 x 1.0 ug
    EUR 339

    ESM1 sgRNA CRISPR Lentivector set (Human)

    K0696601 3 x 1.0 ug
    EUR 339

    Esm1 sgRNA CRISPR Lentivector set (Rat)

    K6942301 3 x 1.0 ug
    EUR 339

    ESM1/Endocan ELISA Kit (Human) (OKBB00371)

    OKBB00371 96 Wells
    EUR 505
    Description: Description of target: Endothelial cell-specific molecule 1, also known as Endocan, is a protein that in humans is encoded by the ESM1 gene. This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. ESM1 has been described as a specific biomarker of tip cells during neoangiogenesis by independent teams. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF (vascular endothelial growth factor) or FGF-2 (fibroblast growth factor 2).;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

    ESM1/Endocan ELISA Kit (Mouse) (OKBB00372)

    OKBB00372 96 Wells
    EUR 505
    Description: Description of target: Endothelial cell-specific molecule 1, also known as Endocan, is a protein that in humans is encoded by the ESM1 gene. This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. ESM-1 has been described as a specific biomarker of tip cells during neoangiogenesis by independent teams. Its expression has been shown to be increase in presence of pro-angiogenic growth factors such as VEGF (vascular endothelial growth factor) or FGF-2 (fibroblast growth factor 2).;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

    Active Endothelial Cell Specific Molecule 1 (ESM1)

    • EUR 794.40
    • EUR 316.00
    • EUR 2704.00
    • EUR 968.00
    • EUR 1836.00
    • EUR 595.00
    • EUR 6610.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9NQ30
    • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 19.4kDa
    • Isoelectric Point: 6.7
    Description: Recombinant Human Endothelial Cell Specific Molecule 1 expressed in: E.coli

    Endothelial Cell-Specific Molecule 1 (ESM1) Protein

    • EUR 3418.00
    • EUR 328.00
    • EUR 230.00
    • 1 mg
    • 20 ug
    • 5 ug
    • Shipped within 5-10 working days.

    Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K3500802 1.0 ug DNA
    EUR 154

    Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K3500803 1.0 ug DNA
    EUR 154

    Esm1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K3500804 1.0 ug DNA
    EUR 154

    Mouse Endothelial cell-specific molecule 1 (Esm1)

    • EUR 505.00
    • EUR 265.00
    • EUR 1827.00
    • EUR 766.00
    • EUR 1218.00
    • EUR 335.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 33.7 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Mouse Endothelial cell-specific molecule 1(Esm1) expressed in E.coli

    ESM1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0696602 1.0 ug DNA
    EUR 154

    ESM1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0696603 1.0 ug DNA
    EUR 154

    ESM1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0696604 1.0 ug DNA
    EUR 154

    Esm1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6942302 1.0 ug DNA
    EUR 154

    Esm1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6942303 1.0 ug DNA
    EUR 154

    Esm1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6942304 1.0 ug DNA
    EUR 154

    Recombinant Endothelial Cell Specific Molecule 1 (ESM1)

    • EUR 377.76
    • EUR 204.00
    • EUR 1141.60
    • EUR 447.20
    • EUR 794.40
    • EUR 316.00
    • EUR 2704.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9NQ30
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 19.6kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Endothelial Cell Specific Molecule 1 expressed in: E.coli

    Recombinant Endothelial Cell Specific Molecule 1 (ESM1)

    • EUR 427.94
    • EUR 217.00
    • EUR 1329.76
    • EUR 509.92
    • EUR 919.84
    • EUR 349.00
    • EUR 3174.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9QYY7
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 67.7kDa
    • Isoelectric Point: 5.4
    Description: Recombinant Mouse Endothelial Cell Specific Molecule 1 expressed in: E.coli

    Recombinant Endothelial Cell Specific Molecule 1 (ESM1)

    • EUR 427.94
    • EUR 217.00
    • EUR 1329.76
    • EUR 509.92
    • EUR 919.84
    • EUR 349.00
    • EUR 3174.40
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9QYY7
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 49.7kDa
    • Isoelectric Point: 5.8
    Description: Recombinant Mouse Endothelial Cell Specific Molecule 1 expressed in: E.coli

    Recombinant Endothelial Cell Specific Molecule 1 (ESM1)

    • EUR 447.65
    • EUR 223.00
    • EUR 1403.68
    • EUR 534.56
    • EUR 969.12
    • EUR 362.00
    • EUR 3359.20
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: P97682
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 19.3kDa
    • Isoelectric Point: 5.7
    Description: Recombinant Rat Endothelial Cell Specific Molecule 1 expressed in: E.coli

    ESM1 Protein Vector (Mouse) (pPB-C-His)

    PV176334 500 ng
    EUR 603

    ESM1 Protein Vector (Mouse) (pPB-N-His)

    PV176335 500 ng
    EUR 603

    ESM1 Protein Vector (Mouse) (pPM-C-HA)

    PV176336 500 ng
    EUR 603

    ESM1 Protein Vector (Mouse) (pPM-C-His)

    PV176337 500 ng
    EUR 603

    Recombinant Human ESM1 Protein, His, E.coli-10ug

    QP11810-HIS-10ug 10ug
    EUR 201

    Recombinant Human ESM1 Protein, His, E.coli-20ug

    QP11810-HIS-20ug 20ug
    EUR 201

    Recombinant Human ESM1 Protein, His, E.coli-2ug

    QP11810-HIS-2ug 2ug
    EUR 155

    Recombinant Human ESM1 Protein, His, E.coli-5ug

    QP11810-HIS-5ug 5ug
    EUR 155

    Recombinant Human ESM1 Protein, His, E.coli-1mg

    QP11810-HIS-EC-1mg 1mg
    EUR 2757

    ESM1 Protein Vector (Human) (pPB-C-His)

    PV014585 500 ng
    EUR 329

    ESM1 Protein Vector (Human) (pPB-N-His)

    PV014586 500 ng
    EUR 329

    ESM1 Protein Vector (Human) (pPM-C-HA)

    PV014587 500 ng
    EUR 329

    ESM1 Protein Vector (Human) (pPM-C-His)

    PV014588 500 ng
    EUR 329

    ESM1 Protein Vector (Rat) (pPB-C-His)

    PV266614 500 ng
    EUR 603

    ESM1 Protein Vector (Rat) (pPB-N-His)

    PV266615 500 ng
    EUR 603

    ESM1 Protein Vector (Rat) (pPM-C-HA)

    PV266616 500 ng
    EUR 603

    ESM1 Protein Vector (Rat) (pPM-C-His)

    PV266617 500 ng
    EUR 603

    Esm1 3'UTR Luciferase Stable Cell Line

    TU204106 1.0 ml Ask for price

    Esm1 3'UTR GFP Stable Cell Line

    TU155951 1.0 ml Ask for price

    ESM1 3'UTR Luciferase Stable Cell Line

    TU007059 1.0 ml
    EUR 1394

    Esm1 3'UTR Luciferase Stable Cell Line

    TU105951 1.0 ml Ask for price

    ESM1 3'UTR GFP Stable Cell Line

    TU057059 1.0 ml
    EUR 1394

    Esm1 3'UTR GFP Stable Cell Line

    TU254106 1.0 ml Ask for price

    ESM1 ELISA Kit (Human) : 96 Wells (OKEH02734)

    OKEH02734 96 Wells
    EUR 662
    Description: Description of target: This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. Two transcript variants encoding different isoforms have been found for this gene. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 12 pg/mL

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ESM1 Rabbit Polyclonal Antibody