DERL3 Rabbit Polyclonal Antibody

DERL3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DERL3 Polyclonal Antibody
    ABP58355-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human DERL3 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of DERL3 from Human, Mouse. This DERL3 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DERL3 protein
    DERL3 Polyclonal Antibody
    ES11969-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    DERL3 Polyclonal Antibody
    ES11969-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against DERL3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    DERL3 antibody
    70R-6365 50 ug
    EUR 467
    Description: Rabbit polyclonal DERL3 antibody raised against the middle region of DERL3
    DERL3 antibody
    70R-6366 50 ug
    EUR 467
    Description: Rabbit polyclonal DERL3 antibody raised against the C terminal of DERL3
    Anti-DERL3 antibody
    STJ193127 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DERL3
    DERL3 siRNA
    20-abx914024
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    DERL3 siRNA
    20-abx914025
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Polyclonal Derlin-3 / DERL3 Antibody (N-Terminus)
    APR15724G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Derlin-3 / DERL3 (N-Terminus). This antibody is tested and proven to work in the following applications:
    DERL3 Blocking Peptide
    33R-2886 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6365
    DERL3 Blocking Peptide
    33R-10295 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DERL3 antibody, catalog no. 70R-6366
    DERL3 cloning plasmid
    CSB-CL836283HU-10ug 10ug
    EUR 308
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 708
    • Sequence: atggcgtggcagggactagcggccgagttcctgcaggtgccggcggtgacgcgggcttacaccgcagcctgtgtcctcaccaccgccgcggtgcagctggagctcctcagcccctttcaactctacttcaacccgcaccttgtgttccggaagttccaggtctggaggctcgtcac
    • Show more
    Description: A cloning plasmid for the DERL3 gene.
    Mouse DERL3 shRNA Plasmid
    20-abx977193
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human DERL3 shRNA Plasmid
    20-abx964027
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    DERL3 Recombinant Protein (Human)
    RP009172 100 ug Ask for price
    DERL3 Recombinant Protein (Rat)
    RP197897 100 ug Ask for price
    DERL3 Recombinant Protein (Mouse)
    RP128810 100 ug Ask for price
    Derl3 ORF Vector (Rat) (pORF)
    ORF065967 1.0 ug DNA
    EUR 506
    DERL3 ORF Vector (Human) (pORF)
    ORF003058 1.0 ug DNA
    EUR 95
    Derl3 ORF Vector (Mouse) (pORF)
    ORF042938 1.0 ug DNA
    EUR 506
    Human Derlin- 3, DERL3 ELISA KIT
    ELI-26357h 96 Tests
    EUR 824
    Bovine Derlin- 3, DERL3 ELISA KIT
    ELI-46941b 96 Tests
    EUR 928
    Mouse Derlin- 3, Derl3 ELISA KIT
    ELI-47008m 96 Tests
    EUR 865
    DERL3 sgRNA CRISPR Lentivector set (Human)
    K0585401 3 x 1.0 ug
    EUR 339
    Derl3 sgRNA CRISPR Lentivector set (Rat)
    K6111901 3 x 1.0 ug
    EUR 339
    Derl3 sgRNA CRISPR Lentivector set (Mouse)
    K4041101 3 x 1.0 ug
    EUR 339
    Human Derlin 3(DERL3)ELISA Kit
    QY-E04982 96T
    EUR 361
    DERL3 sgRNA CRISPR Lentivector (Human) (Target 1)
    K0585402 1.0 ug DNA
    EUR 154
    DERL3 sgRNA CRISPR Lentivector (Human) (Target 2)
    K0585403 1.0 ug DNA
    EUR 154
    DERL3 sgRNA CRISPR Lentivector (Human) (Target 3)
    K0585404 1.0 ug DNA
    EUR 154
    Derl3 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6111902 1.0 ug DNA
    EUR 154
    Derl3 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6111903 1.0 ug DNA
    EUR 154
    Derl3 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6111904 1.0 ug DNA
    EUR 154
    Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4041102 1.0 ug DNA
    EUR 154
    Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4041103 1.0 ug DNA
    EUR 154
    Derl3 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4041104 1.0 ug DNA
    EUR 154
    ELISA kit for Bovine Derlin-3 (DERL3)
    KTE10361-48T 48T
    EUR 354
    • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Bovine Derlin-3 (DERL3)
    KTE10361-5platesof96wells 5 plates of 96 wells
    EUR 2252
    • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Bovine Derlin-3 (DERL3)
    KTE10361-96T 96T
    EUR 572
    • Derlin-3 (DERL3) belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be involved in
    • Show more
    Description: Quantitative sandwich ELISA for measuring Bovine Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Derlin-3 (DERL3)
    KTE71307-48T 48T
    EUR 332
    • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Derlin-3 (DERL3)
    KTE71307-5platesof96wells 5 plates of 96 wells
    EUR 2115
    • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    ELISA kit for Mouse Derlin-3 (DERL3)
    KTE71307-96T 96T
    EUR 539
    • The protein encoded by DERL3 belongs to the derlin family, and resides in the endoplasmic reticulum (ER). Proteins that are unfolded or misfolded in the ER must be refolded or degraded to maintain the homeostasis of the ER. This protein appears to be
    • Show more
    Description: Quantitative sandwich ELISA for measuring Mouse Derlin-3 (DERL3) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.
    DERL3 Protein Vector (Mouse) (pPB-C-His)
    PV171750 500 ng
    EUR 603
    DERL3 Protein Vector (Mouse) (pPB-N-His)
    PV171751 500 ng
    EUR 603
    DERL3 Protein Vector (Mouse) (pPM-C-HA)
    PV171752 500 ng
    EUR 603
    DERL3 Protein Vector (Mouse) (pPM-C-His)
    PV171753 500 ng
    EUR 603
    DERL3 Protein Vector (Rat) (pPB-C-His)
    PV263866 500 ng
    EUR 603
    DERL3 Protein Vector (Rat) (pPB-N-His)
    PV263867 500 ng
    EUR 603
    DERL3 Protein Vector (Rat) (pPM-C-HA)
    PV263868 500 ng
    EUR 603
    DERL3 Protein Vector (Rat) (pPM-C-His)
    PV263869 500 ng
    EUR 603
    DERL3 Protein Vector (Human) (pPB-C-His)
    PV012229 500 ng
    EUR 329
    DERL3 Protein Vector (Human) (pPB-N-His)
    PV012230 500 ng
    EUR 329
    DERL3 Protein Vector (Human) (pPM-C-HA)
    PV012231 500 ng
    EUR 329
    DERL3 Protein Vector (Human) (pPM-C-His)
    PV012232 500 ng
    EUR 329
    Derl3 3'UTR GFP Stable Cell Line
    TU155082 1.0 ml Ask for price
    Derl3 3'UTR Luciferase Stable Cell Line
    TU105082 1.0 ml Ask for price
    Derl3 3'UTR Luciferase Stable Cell Line
    TU203354 1.0 ml Ask for price
    Derl3 3'UTR GFP Stable Cell Line
    TU253354 1.0 ml Ask for price
    DERL3 3'UTR GFP Stable Cell Line
    TU055834 1.0 ml
    EUR 1521
    DERL3 3'UTR Luciferase Stable Cell Line
    TU005834 1.0 ml
    EUR 1521
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252
    EBFP Rabbit Polyclonal Antibody
    38087-50ul 50ul
    EUR 187
    Vimentin Rabbit Polyclonal Antibody
    38104-100ul 100ul
    EUR 252
    Vimentin Rabbit Polyclonal Antibody
    38104-50ul 50ul
    EUR 187
    LDHD Rabbit Polyclonal Antibody
    38105-100ul 100ul
    EUR 252
    LDHD Rabbit Polyclonal Antibody
    38105-50ul 50ul
    EUR 187
    GAPDH Rabbit Polyclonal Antibody
    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    GAPDH Rabbit Polyclonal Antibody
    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein
    Rabbit Hemoglobin Polyclonal Antibody
    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products
    Met Rabbit Polyclonal Antibody
    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    Met Rabbit Polyclonal Antibody
    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET
    VEGF Rabbit Polyclonal Antibody
    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    VEGF Rabbit Polyclonal Antibody
    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA
    CD10 Rabbit Polyclonal Antibody
    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    CD10 Rabbit Polyclonal Antibody
    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME
    NM23A Rabbit Polyclonal Antibody
    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1
    NM23A Rabbit Polyclonal Antibody
    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    DERL3 Rabbit Polyclonal Antibody