RBM10 Rabbit Polyclonal Antibody

RBM10 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RBM10 Polyclonal Antibody

    ABP60115-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human RBM10 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of RBM10 from Human, Mouse, Rat. This RBM10 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RBM10 protein

    RBM10 Polyclonal Antibody

    ES11966-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against RBM10 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    RBM10 Polyclonal Antibody

    ES11966-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against RBM10 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    RBM10 Rabbit pAb

    A4209-100ul 100 ul
    EUR 308

    RBM10 Rabbit pAb

    A4209-200ul 200 ul
    EUR 459

    RBM10 Rabbit pAb

    A4209-20ul 20 ul
    EUR 183

    RBM10 Rabbit pAb

    A4209-50ul 50 ul
    EUR 223

    RBM10 antibody

    70R-19802 50 ul
    EUR 435
    Description: Rabbit polyclonal RBM10 antibody

    RBM10 Antibody

    47325-100ul 100ul
    EUR 252

    RBM10 Antibody

    1-CSB-PA019400GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    RBM10 Antibody

    1-CSB-PA019400LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:2000-1:10000, IHC:1:20-1:200, IF:1:50-1:200

    RBM10 Polyclonal Antibody, HRP Conjugated

    A63295 100 µg
    EUR 570.55
    Description: reagents widely cited

    RBM10 Polyclonal Antibody, FITC Conjugated

    A63296 100 µg
    EUR 570.55
    Description: Ask the seller for details

    RBM10 Polyclonal Antibody, Biotin Conjugated

    A63297 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Rbm10/ Rat Rbm10 ELISA Kit

    ELI-36004r 96 Tests
    EUR 886

    RBM10 Conjugated Antibody

    C47325 100ul
    EUR 397

    anti- RBM10 antibody

    FNab07158 100µg
    EUR 548.75
    • Immunogen: RNA binding motif protein 10
    • Uniprot ID: P98175
    • Gene ID: 8241
    • Research Area: Metabolism
    Description: Antibody raised against RBM10

    Anti-RBM10 antibody

    PAab07158 100 ug
    EUR 386

    Anti-RBM10 antibody

    STJ25312 100 µl
    EUR 277
    Description: This gene encodes a nuclear protein that belongs to a family proteins that contain an RNA-binding motif. The encoded protein associates with hnRNP proteins and may be involved in regulating alternative splicing. Defects in this gene are the cause of the X-linked recessive disorder, TARP syndrome. Alternate splicing results in multiple transcript variants.

    Anti-RBM10 antibody

    STJ193124 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RBM10

    RBM10 siRNA

    20-abx904494
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBM10 siRNA

    20-abx931024
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBM10 siRNA

    20-abx931025
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBM10 Antibody, HRP conjugated

    1-CSB-PA019400LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    RBM10 Antibody, FITC conjugated

    1-CSB-PA019400LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    RBM10 Antibody, Biotin conjugated

    1-CSB-PA019400LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBM10. Recognizes RBM10 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    RBM10 cloning plasmid

    CSB-CL019400HU1-10ug 10ug
    EUR 558
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2793
    • Sequence: atggagtatgaaagacgtggtggtcgtggtgacaggactggccgctatggagccactgaccgctcgcaggatgatggtggggagaaccgcagccgagaccacgactaccgggacatggactaccgttcatatcctcgcgagtatggcagccaggagggcaagcatgactatgacg
    • Show more
    Description: A cloning plasmid for the RBM10 gene.

    RBM10 cloning plasmid

    CSB-CL019400HU2-10ug 10ug
    EUR 826
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2559
    • Sequence: atggagtatgaaagacgtggtggtcgtggtgacaggactggccgctatggagccactgaccgctcgcaggatgatggtggggagaaccgcagccgagaccacgactaccgggacatggactaccgttcatatcctcgcgagtatggcagccaggagggcaagcatgactatgacg
    • Show more
    Description: A cloning plasmid for the RBM10 gene.

    Anti-RBM10 (2F12)

    YF-MA16316 100 ug
    EUR 363
    Description: Mouse monoclonal to RBM10

    RBM10 ELISA KIT|Human

    EF002345 96 Tests
    EUR 689

    Rat RBM10 shRNA Plasmid

    20-abx986260
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human RBM10 shRNA Plasmid

    20-abx955411
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse RBM10 shRNA Plasmid

    20-abx982250
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    h RBM10 inducible lentivirus

    LVP1124 1x107 IFU/ml x 200ul
    EUR 451
    Description: Pre-made over-expression lentivirus for expressing human target: RBM10 (RNA binding motif protein 10), [alternative names: DXS8237E; GPATC9; GPATCH9; S1-1; TARPS; ZRANB5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_005676.4 . It also contains a RFP-Blasticidin dual selection marker.

    RNA Binding Motif Protein 10 (RBM10) Antibody

    20-abx003115
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Rna Binding Motif Protein 10 (RBM10) Antibody

    20-abx115309
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    RNA Binding Motif Protein 10 (RBM10) Antibody

    abx028559-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    RNA Binding Motif Protein 10 (RBM10) Antibody

    abx028559-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    RNA Binding Motif Protein 10 (RBM10) Antibody

    abx237158-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    RNA Binding Motif Protein 10 (RBM10) Antibody

    20-abx317941
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Rbm10 ORF Vector (Rat) (pORF)

    ORF074599 1.0 ug DNA
    EUR 506

    h RBM10 (GFP-Puro) Lentivirus

    LVP1124-GP 1x107 IFU/ml x 200ul
    EUR 451
    Description: Pre-made over-expression lentivirus for expressing human target: RBM10 (RNA binding motif protein 10), [alternative names: DXS8237E; GPATC9; GPATCH9; S1-1; TARPS; ZRANB5]. The sub-cloned codon sequence is identical (100% match) to CDS region in NCBI ID: NM_005676.4 . It also contains a GFP-Puromycin dual selection marker.

    RBM10 ORF Vector (Human) (pORF)

    ORF008630 1.0 ug DNA
    EUR 95

    RBM10 ORF Vector (Human) (pORF)

    ORF008631 1.0 ug DNA
    EUR 95

    Rbm10 ORF Vector (Mouse) (pORF)

    ORF055699 1.0 ug DNA
    EUR 506

    Rbm10 ORF Vector (Mouse) (pORF)

    ORF055700 1.0 ug DNA
    EUR 506

    Rbm10 ORF Vector (Mouse) (pORF)

    ORF055701 1.0 ug DNA
    EUR 506

    Cytokeratin 10 MonoSpecific Antibody, Unconjugated-20ug

    3858-RBM10-P0 20ug
    EUR 233

    Cytokeratin 10 MonoSpecific Antibody, Unconjugated-100ug

    3858-RBM10-P1 100ug
    EUR 428

    RNA Binding Motif Protein 10 (RBM10) Antibody (HRP)

    20-abx305067
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    RNA Binding Motif Protein 10 (RBM10) Antibody (FITC)

    20-abx305068
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    RNA Binding Motif Protein 10 (RBM10) Antibody (Biotin)

    20-abx305069
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Anti-CD44v4 Antibody Clone CD44v4/1700R, Unconjugated-20ug

    960-RBM10-P0 20ug
    EUR 233

    Anti-CD44v4 Antibody Clone CD44v4/1700R, Unconjugated-100ug

    960-RBM10-P1 100ug
    EUR 428

    Rbm10 sgRNA CRISPR Lentivector set (Rat)

    K7078301 3 x 1.0 ug
    EUR 339

    Rbm10 sgRNA CRISPR Lentivector set (Mouse)

    K4688801 3 x 1.0 ug
    EUR 339

    RBM10 sgRNA CRISPR Lentivector set (Human)

    K1793201 3 x 1.0 ug
    EUR 339

    Anti-p53 Tumor Suppressor Protein Antibody Clone TP53/1799R, Unconjugated-20ug

    7157-RBM10-P0 20ug
    EUR 233

    Anti-p53 Tumor Suppressor Protein Antibody Clone TP53/1799R, Unconjugated-100ug

    7157-RBM10-P1 100ug
    EUR 428

    Rbm10 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7078302 1.0 ug DNA
    EUR 154

    Rbm10 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7078303 1.0 ug DNA
    EUR 154

    Rbm10 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7078304 1.0 ug DNA
    EUR 154

    Rbm10 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4688802 1.0 ug DNA
    EUR 154

    Rbm10 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4688803 1.0 ug DNA
    EUR 154

    Rbm10 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4688804 1.0 ug DNA
    EUR 154

    RBM10 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1793202 1.0 ug DNA
    EUR 154

    RBM10 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1793203 1.0 ug DNA
    EUR 154

    RBM10 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1793204 1.0 ug DNA
    EUR 154

    RBM10 Protein Vector (Rat) (pPB-C-His)

    PV298394 500 ng
    EUR 1166

    RBM10 Protein Vector (Rat) (pPB-N-His)

    PV298395 500 ng
    EUR 1166

    RBM10 Protein Vector (Rat) (pPM-C-HA)

    PV298396 500 ng
    EUR 1166

    RBM10 Protein Vector (Rat) (pPM-C-His)

    PV298397 500 ng
    EUR 1166

    RBM10 Protein Vector (Human) (pPB-C-His)

    PV034517 500 ng
    EUR 329

    RBM10 Protein Vector (Human) (pPB-N-His)

    PV034518 500 ng
    EUR 329

    RBM10 Protein Vector (Human) (pPM-C-HA)

    PV034519 500 ng
    EUR 329

    RBM10 Protein Vector (Human) (pPM-C-His)

    PV034520 500 ng
    EUR 329

    RBM10 Protein Vector (Human) (pPB-C-His)

    PV034521 500 ng
    EUR 329

    RBM10 Protein Vector (Human) (pPB-N-His)

    PV034522 500 ng
    EUR 329

    RBM10 Protein Vector (Human) (pPM-C-HA)

    PV034523 500 ng
    EUR 329

    RBM10 Protein Vector (Human) (pPM-C-His)

    PV034524 500 ng
    EUR 329

    RBM10 Protein Vector (Mouse) (pPB-C-His)

    PV222794 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPB-N-His)

    PV222795 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPM-C-HA)

    PV222796 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPM-C-His)

    PV222797 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPB-C-His)

    PV222798 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPB-N-His)

    PV222799 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPM-C-HA)

    PV222800 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPM-C-His)

    PV222801 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPB-C-His)

    PV222802 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPB-N-His)

    PV222803 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPM-C-HA)

    PV222804 500 ng
    EUR 1065

    RBM10 Protein Vector (Mouse) (pPM-C-His)

    PV222805 500 ng
    EUR 1065

    Rbm10 3'UTR Luciferase Stable Cell Line

    TU117603 1.0 ml Ask for price

    Rbm10 3'UTR GFP Stable Cell Line

    TU167603 1.0 ml Ask for price

    Rbm10 3'UTR Luciferase Stable Cell Line

    TU217368 1.0 ml Ask for price

    Rbm10 3'UTR GFP Stable Cell Line

    TU267368 1.0 ml Ask for price

    RBM10 3'UTR GFP Stable Cell Line

    TU069588 1.0 ml
    EUR 1394

    RBM10 Rabbit Polyclonal Antibody