OCLN Rabbit Polyclonal Antibody

OCLN Rabbit Polyclonal Antibody

Contact Us Below To Order :

    OCLN Polyclonal Antibody

    ABP59636-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human OCLN protein
    • Applications tips:
    Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

    OCLN Polyclonal Antibody

    ES11811-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against OCLN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    OCLN Polyclonal Antibody

    ES11811-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against OCLN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

    Human Occludin (OCLN) ELISA Kit

    DLR-OCLN-Hu-48T 48T
    EUR 517
    • Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Occludin (OCLN) ELISA Kit

    DLR-OCLN-Hu-96T 96T
    EUR 673
    • Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Mouse Occludin (OCLN) ELISA Kit

    DLR-OCLN-Mu-48T 48T
    EUR 527
    • Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Mouse Occludin (OCLN) ELISA Kit

    DLR-OCLN-Mu-96T 96T
    EUR 688
    • Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Occludin (OCLN) ELISA Kit

    DLR-OCLN-Ra-48T 48T
    EUR 549
    • Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Occludin (OCLN) ELISA Kit

    DLR-OCLN-Ra-96T 96T
    EUR 718
    • Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Occludin (OCLN) ELISA Kit

    RDR-OCLN-Hu-48Tests 48 Tests
    EUR 544

    Human Occludin (OCLN) ELISA Kit

    RDR-OCLN-Hu-96Tests 96 Tests
    EUR 756

    Mouse Occludin (OCLN) ELISA Kit

    RDR-OCLN-Mu-48Tests 48 Tests
    EUR 557

    Mouse Occludin (OCLN) ELISA Kit

    RDR-OCLN-Mu-96Tests 96 Tests
    EUR 774

    Rat Occludin (OCLN) ELISA Kit

    RDR-OCLN-Ra-48Tests 48 Tests
    EUR 583

    Rat Occludin (OCLN) ELISA Kit

    RDR-OCLN-Ra-96Tests 96 Tests
    EUR 811

    Human Occludin (OCLN) ELISA Kit

    RD-OCLN-Hu-48Tests 48 Tests
    EUR 521

    Human Occludin (OCLN) ELISA Kit

    RD-OCLN-Hu-96Tests 96 Tests
    EUR 723

    Mouse Occludin (OCLN) ELISA Kit

    RD-OCLN-Mu-48Tests 48 Tests
    EUR 533

    Mouse Occludin (OCLN) ELISA Kit

    RD-OCLN-Mu-96Tests 96 Tests
    EUR 740

    Rat Occludin (OCLN) ELISA Kit

    RD-OCLN-Ra-48Tests 48 Tests
    EUR 557

    Rat Occludin (OCLN) ELISA Kit

    RD-OCLN-Ra-96Tests 96 Tests
    EUR 775

    Polyclonal OCLN Antibody (C-term)

    APR17653G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OCLN (C-term). This antibody is tested and proven to work in the following applications:

    Occludin (OCLN) Polyclonal Antibody (Mouse)

    • EUR 251.00
    • EUR 2576.00
    • EUR 640.00
    • EUR 316.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN)

    OCLN Antibody

    24902-100ul 100ul
    EUR 390

    OCLN antibody

    70R-19023 50 ul
    EUR 435
    Description: Rabbit polyclonal OCLN antibody

    OCLN Antibody

    35850-100ul 100ul
    EUR 252

    OCLN Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

    OCLN Antibody

    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    OCLN Antibody

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

    OCLN Antibody

    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

    Rabbit OCLN ELISA Kit

    ERTO0016 96Tests
    EUR 521


    RA34003 100 ul
    EUR 644

    Occludin (OCLN) Polyclonal Antibody (Mouse), APC

    • EUR 351.00
    • EUR 3365.00
    • EUR 935.00
    • EUR 449.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC.

    Occludin (OCLN) Polyclonal Antibody (Mouse), Biotinylated

    • EUR 316.00
    • EUR 2526.00
    • EUR 744.00
    • EUR 387.00
    • EUR 221.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Biotin.

    Occludin (OCLN) Polyclonal Antibody (Mouse), Cy3

    • EUR 427.00
    • EUR 4445.00
    • EUR 1205.00
    • EUR 557.00
    • EUR 254.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Cy3.

    Occludin (OCLN) Polyclonal Antibody (Mouse), FITC

    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with FITC.

    Occludin (OCLN) Polyclonal Antibody (Mouse), HRP

    • EUR 321.00
    • EUR 2933.00
    • EUR 827.00
    • EUR 405.00
    • EUR 209.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with HRP.

    Occludin (OCLN) Polyclonal Antibody (Mouse), PE

    • EUR 301.00
    • EUR 2712.00
    • EUR 768.00
    • EUR 379.00
    • EUR 197.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with PE.

    Occludin (OCLN) Antibody

    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    abx027678-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    abx027678-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Occludin (OCLN) Antibody

    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Occludin (OCLN) Antibody

    • EUR 1302.00
    • EUR 620.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Occludin (OCLN) Antibody

    • EUR 439.00
    • EUR 133.00
    • EUR 1233.00
    • EUR 592.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Occludin (Ocln) Antibody

    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody

    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Occludin (OCLN) Antibody

    • EUR 913.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.

    OCLN Conjugated Antibody

    C35850 100ul
    EUR 397

    Occludin (OCLN) Antibody

    abx235957-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.

    Occludin (OCLN) Antibody

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Anti-OCLN antibody

    STJ111161 100 µl
    EUR 277
    Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

    Anti-OCLN antibody

    STJ114495 100 µl
    EUR 277
    Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

    Anti-OCLN antibody

    STJ192969 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to OCLN

    Rabbit Occludin (OCLN) ELISA Kit

    abx362127-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.

    Ocln/ Rat Ocln ELISA Kit

    ELI-14841r 96 Tests
    EUR 886

    Occludin (OCLN) Polyclonal Antibody (Mouse), APC-Cy7

    • EUR 583.00
    • EUR 6610.00
    • EUR 1750.00
    • EUR 778.00
    • EUR 324.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: OCLN (Phe17~Ser107)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC-Cy7.

    OCLN siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    OCLN siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    OCLN siRNA

    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.


    QY-E05310 96T
    EUR 361

    Rabbit Anti-OCLN monoclonal antibody, clone KK102-19

    DCABH-5086 100 ul
    EUR 777

    OCLN Antibody, HRP conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    OCLN Antibody, FITC conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    OCLN Antibody, Biotin conjugated

    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Occludin (OCLN) Antibody (Biotin)

    • EUR 467.00
    • EUR 244.00
    • EUR 1344.00
    • EUR 634.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Occludin (OCLN) Antibody (HRP)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody (FITC)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Occludin (OCLN) Antibody (Biotin)

    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Anti-Occludin/OCLN Antibody

    RP1057 100ug/vial
    EUR 334

    OCLN cloning plasmid

    CSB-CL016263HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1569
    • Sequence: atgtcatccaggcctcttgaaagtccacctccttacaggcctgatgaattcaaaccgaatcattatgcaccaagcaatgacatatatggtggagagatgcatgttcgaccaatgctctctcagccagcctactctttttacccagaagatgaaattcttcacttctacaaatgga
    • Show more
    Description: A cloning plasmid for the OCLN gene.

    Anti-OCLN (5A7)

    YF-MA20378 100 ug
    EUR 363
    Description: Mouse monoclonal to OCLN

    Recombinant Occludin (OCLN)

    • EUR 476.32
    • EUR 230.00
    • EUR 1511.20
    • EUR 570.40
    • EUR 1040.80
    • EUR 382.00
    • EUR 3628.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q61146
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 11.8kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Mouse Occludin expressed in: E.coli

    Mouse Occludin (OCLN) Protein

    • EUR 662.00
    • EUR 272.00
    • EUR 2040.00
    • EUR 787.00
    • EUR 481.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Human OCLN ELISA Kit

    ELA-E14928h 96 Tests
    EUR 824

    Human OCLN ELISA Kit

    EHO0016 96Tests
    EUR 521

    Bovine OCLN ELISA Kit

    EBO0016 96Tests
    EUR 521

    Anserini OCLN ELISA Kit

    EAO0016 96Tests
    EUR 521


    ECKO0016 96Tests
    EUR 521

    Canine OCLN ELISA Kit

    ECO0016 96Tests
    EUR 521

    Goat OCLN ELISA Kit

    EGTO0016 96Tests
    EUR 521


    ELI-13288d 96 Tests
    EUR 928


    EF005821 96 Tests
    EUR 689

    Mouse OCLN shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Rat OCLN shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human Occludin (OCLN) Protein

    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Rat Occludin (OCLN) Protein

    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Human OCLN shRNA Plasmid

    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Porcine OCLN ELISA Kit

    EPO0016 96Tests
    EUR 521

    Sheep OCLN ELISA Kit

    ESO0016 96Tests
    EUR 521

    Rat OCLN ELISA Kit

    ERO0016 96Tests
    EUR 521

    Monkey OCLN ELISA Kit

    EMKO0016 96Tests
    EUR 521

    Mouse OCLN ELISA Kit

    EMO0016 96Tests
    EUR 521

    OCLN Rabbit Polyclonal Antibody