OCLN Rabbit Polyclonal Antibody

OCLN Rabbit Polyclonal Antibody

Contact Us Below To Order :

OCLN Polyclonal Antibody
ABP59636-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human OCLN protein Applications tips:
Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

OCLN Polyclonal Antibody
ES11811-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against OCLN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

OCLN Polyclonal Antibody
ES11811-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against OCLN from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

Human Occludin (OCLN) ELISA Kit
DLR-OCLN-Hu-48T	DL Develop	48T	EUR 517
Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Occludin (OCLN) ELISA Kit
DLR-OCLN-Hu-96T	DL Develop	96T	EUR 673
Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Occludin (OCLN) ELISA Kit
DLR-OCLN-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Occludin (OCLN) ELISA Kit
DLR-OCLN-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Occludin (OCLN) ELISA Kit
DLR-OCLN-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Occludin (OCLN) ELISA Kit
DLR-OCLN-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Occludin (OCLN) ELISA Kit
RDR-OCLN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Occludin (OCLN) ELISA Kit
RDR-OCLN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Occludin (OCLN) ELISA Kit
RDR-OCLN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Occludin (OCLN) ELISA Kit
RDR-OCLN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Occludin (OCLN) ELISA Kit
RDR-OCLN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Occludin (OCLN) ELISA Kit
RDR-OCLN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Human Occludin (OCLN) ELISA Kit
RD-OCLN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Occludin (OCLN) ELISA Kit
RD-OCLN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Occludin (OCLN) ELISA Kit
RD-OCLN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Occludin (OCLN) ELISA Kit
RD-OCLN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Occludin (OCLN) ELISA Kit
RD-OCLN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Occludin (OCLN) ELISA Kit
RD-OCLN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Rabbit OCLN ELISA Kit
ERTO0016	Abclonal	96Tests	EUR 521

Polyclonal OCLN Antibody (C-term)
APR17653G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OCLN (C-term). This antibody is tested and proven to work in the following applications:

Occludin (OCLN) Polyclonal Antibody (Mouse)
4-PAC228Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN)

OCLN Antibody
24902-100ul	SAB	100ul	EUR 390

OCLN antibody
70R-19023	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal OCLN antibody

OCLN Antibody
35850-100ul	SAB	100ul	EUR 252

OCLN Antibody
1-CSB-PA385632	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

OCLN Antibody
1-CSB-PA016263GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

OCLN Antibody
1-CSB-PA016263LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

OCLN Antibody
1-CSB-PA190654	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

OCLN
RA34003	Neuromics	100 ul	EUR 644

Occludin (OCLN) Polyclonal Antibody (Mouse), APC
4-PAC228Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC.

Occludin (OCLN) Polyclonal Antibody (Mouse), Biotinylated
4-PAC228Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Biotin.

Occludin (OCLN) Polyclonal Antibody (Mouse), Cy3
4-PAC228Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Cy3.

Occludin (OCLN) Polyclonal Antibody (Mouse), FITC
4-PAC228Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with FITC.

Occludin (OCLN) Polyclonal Antibody (Mouse), HRP
4-PAC228Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with HRP.

Occludin (OCLN) Polyclonal Antibody (Mouse), PE
4-PAC228Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with PE.

Rabbit Occludin (OCLN) ELISA Kit
abx362127-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Occludin (OCLN) Antibody
20-abx005226	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
abx027678-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
abx027678-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx213716	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx213972	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx217323	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx177849	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Occludin (OCLN) Antibody
20-abx177850	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Occludin (OCLN) Antibody
20-abx177851	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Occludin (OCLN) Antibody
20-abx100283	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Occludin (Ocln) Antibody
20-abx114256	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx135728	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx173883	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Occludin (OCLN) Antibody
20-abx173884	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

OCLN Conjugated Antibody
C35850	SAB	100ul	EUR 397

Occludin (OCLN) Antibody
abx235957-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Occludin (OCLN) Antibody
20-abx338520	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-OCLN antibody
STJ111161	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

Anti-OCLN antibody
STJ114495	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

Anti-OCLN antibody
STJ192969	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to OCLN

Ocln/ Rat Ocln ELISA Kit
ELI-14841r	Lifescience Market	96 Tests	EUR 886

Occludin (OCLN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC228Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC-Cy7.

OCLN siRNA
20-abx903729	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OCLN siRNA
20-abx926764	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OCLN siRNA
20-abx926765	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human(OCLN)
QY-E05310	Qayee Biotechnology	96T	EUR 361

Rabbit Anti-OCLN monoclonal antibody, clone KK102-19
DCABH-5086	Creative Diagnostics	100 ul	EUR 777

OCLN Antibody, HRP conjugated
1-CSB-PA016263LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OCLN Antibody, FITC conjugated
1-CSB-PA016263LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OCLN Antibody, Biotin conjugated
1-CSB-PA016263LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Occludin (OCLN) Antibody (Biotin)
20-abx272823	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Occludin (OCLN) Antibody (HRP)
20-abx336871	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Occludin (OCLN) Antibody (FITC)
20-abx336872	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Occludin (OCLN) Antibody (Biotin)
20-abx336873	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Occludin/OCLN Antibody
RP1057	BosterBio	100ug/vial	EUR 334

OCLN cloning plasmid
CSB-CL016263HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1569 Sequence: atgtcatccaggcctcttgaaagtccacctccttacaggcctgatgaattcaaaccgaatcattatgcaccaagcaatgacatatatggtggagagatgcatgttcgaccaatgctctctcagccagcctactctttttacccagaagatgaaattcttcacttctacaaatgga Show more
Description: A cloning plasmid for the OCLN gene.

Recombinant Occludin (OCLN)
4-RPC228Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61146 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 11.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Occludin expressed in: E.coli

Anti-OCLN (5A7)
YF-MA20378	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OCLN

Mouse Occludin (OCLN) Protein
20-abx068376	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human OCLN ELISA Kit
ELA-E14928h	Lifescience Market	96 Tests	EUR 824

Human OCLN ELISA Kit
EHO0016	Abclonal	96Tests	EUR 521

Bovine OCLN ELISA Kit
EBO0016	Abclonal	96Tests	EUR 521

Anserini OCLN ELISA Kit
EAO0016	Abclonal	96Tests	EUR 521

CHICKEN OCLN ELISA KIT
ECKO0016	Abclonal	96Tests	EUR 521

Canine OCLN ELISA Kit
ECO0016	Abclonal	96Tests	EUR 521

Goat OCLN ELISA Kit
EGTO0016	Abclonal	96Tests	EUR 521

Canine OCLN ELISA KIT
ELI-13288d	Lifescience Market	96 Tests	EUR 928

OCLN ELISA KIT|Human
EF005821	Lifescience Market	96 Tests	EUR 689

Mouse OCLN shRNA Plasmid
20-abx971853	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Rat OCLN shRNA Plasmid
20-abx986766	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human Occludin (OCLN) Protein
20-abx654597	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Occludin (OCLN) Protein
20-abx654599	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Human OCLN shRNA Plasmid
20-abx968922	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Porcine OCLN ELISA Kit
EPO0016	Abclonal	96Tests	EUR 521

Sheep OCLN ELISA Kit
ESO0016	Abclonal	96Tests	EUR 521

Rat OCLN ELISA Kit
ERO0016	Abclonal	96Tests	EUR 521

Monkey OCLN ELISA Kit
EMKO0016	Abclonal	96Tests	EUR 521

Mouse OCLN ELISA Kit
EMO0016	Abclonal	96Tests	EUR 521

OCLN Rabbit Polyclonal Antibody