OCLN Rabbit Polyclonal Antibody

OCLN Rabbit Polyclonal Antibody

Contact Us Below To Order :

OCLN Polyclonal Antibody
ABP59636-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human OCLN protein Applications tips:
Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

OCLN Polyclonal Antibody
ABP59636-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human OCLN protein Applications tips:
Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

OCLN Polyclonal Antibody
ABP59636-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human OCLN protein Applications tips:
Description: A polyclonal antibody for detection of OCLN from Human, Mouse, Rat. This OCLN antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human OCLN protein

Human Occludin (OCLN) ELISA Kit
DLR-OCLN-Hu-48T	DL Develop	48T	EUR 517
Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Occludin (OCLN) ELISA Kit
DLR-OCLN-Hu-96T	DL Develop	96T	EUR 673
Should the Human Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Occludin (OCLN) ELISA Kit
DLR-OCLN-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Occludin (OCLN) ELISA Kit
DLR-OCLN-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Occludin (OCLN) ELISA Kit
DLR-OCLN-Ra-48T	DL Develop	48T	EUR 549
Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Occludin (OCLN) ELISA Kit
DLR-OCLN-Ra-96T	DL Develop	96T	EUR 718
Should the Rat Occludin (OCLN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Occludin (OCLN) ELISA Kit
RD-OCLN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Occludin (OCLN) ELISA Kit
RD-OCLN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Occludin (OCLN) ELISA Kit
RD-OCLN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Occludin (OCLN) ELISA Kit
RD-OCLN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Occludin (OCLN) ELISA Kit
RD-OCLN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Occludin (OCLN) ELISA Kit
RD-OCLN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Occludin (OCLN) ELISA Kit
RDR-OCLN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Occludin (OCLN) ELISA Kit
RDR-OCLN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Occludin (OCLN) ELISA Kit
RDR-OCLN-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Occludin (OCLN) ELISA Kit
RDR-OCLN-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Occludin (OCLN) ELISA Kit
RDR-OCLN-Ra-48Tests	Reddot Biotech	48 Tests	EUR 583

Rat Occludin (OCLN) ELISA Kit
RDR-OCLN-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rabbit OCLN ELISA Kit
ERTO0016	Abclonal	96Tests	EUR 521

Polyclonal OCLN Antibody (C-term)
APR17653G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human OCLN (C-term). This antibody is tested and proven to work in the following applications:

Occludin (OCLN) Polyclonal Antibody (Mouse)
4-PAC228Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN)

OCLN Antibody
35850-100ul	SAB	100ul	EUR 252

OCLN Antibody
24902-100ul	SAB	100ul	EUR 390

OCLN antibody
70R-19023	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal OCLN antibody

OCLN Antibody
1-CSB-PA385632	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:2000, IHC:1:15-1:50

OCLN Antibody
1-CSB-PA190654	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:2000, WB:1:200-1:1000, IHC:1:15-1:50

OCLN Antibody
1-CSB-PA016263GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

OCLN Antibody
1-CSB-PA016263LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:200-1:500, IF:1:50-1:200

OCLN
RA34003	Neuromics	100 ul	EUR 644

Occludin (OCLN) Polyclonal Antibody (Mouse), APC
4-PAC228Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC.

Occludin (OCLN) Polyclonal Antibody (Mouse), Biotinylated
4-PAC228Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Biotin.

Occludin (OCLN) Polyclonal Antibody (Mouse), Cy3
4-PAC228Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with Cy3.

Occludin (OCLN) Polyclonal Antibody (Mouse), FITC
4-PAC228Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with FITC.

Occludin (OCLN) Polyclonal Antibody (Mouse), HRP
4-PAC228Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with HRP.

Occludin (OCLN) Polyclonal Antibody (Mouse), PE
4-PAC228Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with PE.

Rabbit Occludin (OCLN) ELISA Kit
abx362127-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

OCLN Conjugated Antibody
C35850	SAB	100ul	EUR 397

Occludin (Ocln) Antibody
20-abx114256	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx135728	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx100283	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Occludin (OCLN) Antibody
20-abx005226	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
abx027678-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
abx027678-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx173883	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Occludin (OCLN) Antibody
20-abx173884	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Occludin (OCLN) Antibody
20-abx177849	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Occludin (OCLN) Antibody
20-abx177850	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Occludin (OCLN) Antibody
20-abx177851	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Occludin (OCLN) Antibody
20-abx213716	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx213972	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx217323	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
20-abx338520	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Occludin (OCLN) Antibody
abx235957-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Anti-OCLN antibody
STJ111161	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

Anti-OCLN antibody
STJ114495	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.

Anti-OCLN antibody
STJ192969	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to OCLN

Ocln/ Rat Ocln ELISA Kit
ELI-14841r	Lifescience Market	96 Tests	EUR 886

Occludin (OCLN) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC228Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: OCLN (Phe17~Ser107) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Occludin (OCLN). This antibody is labeled with APC-Cy7.

OCLN siRNA
20-abx903729	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OCLN siRNA
20-abx926764	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

OCLN siRNA
20-abx926765	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Human(OCLN)
QY-E05310	Qayee Biotechnology	96T	EUR 361

Rabbit Anti-OCLN monoclonal antibody, clone KK102-19
DCABH-5086	Creative Diagnostics	100 ul	EUR 777

Occludin (OCLN) Antibody (HRP)
20-abx336871	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Occludin (OCLN) Antibody (FITC)
20-abx336872	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Occludin (OCLN) Antibody (Biotin)
20-abx336873	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Occludin (OCLN) Antibody (Biotin)
20-abx272823	Abbexa	EUR 467.00 EUR 244.00 EUR 1344.00 EUR 634.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

OCLN Antibody, HRP conjugated
1-CSB-PA016263LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

OCLN Antibody, FITC conjugated
1-CSB-PA016263LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

OCLN Antibody, Biotin conjugated
1-CSB-PA016263LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against OCLN. Recognizes OCLN from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-Occludin/OCLN Antibody
RP1057	BosterBio	100ug/vial	EUR 334

OCLN cloning plasmid
CSB-CL016263HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1569 Sequence: atgtcatccaggcctcttgaaagtccacctccttacaggcctgatgaattcaaaccgaatcattatgcaccaagcaatgacatatatggtggagagatgcatgttcgaccaatgctctctcagccagcctactctttttacccagaagatgaaattcttcacttctacaaatgga Show more
Description: A cloning plasmid for the OCLN gene.

Recombinant Occludin (OCLN)
4-RPC228Mu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q61146 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 11.8kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Occludin expressed in: E.coli

Anti-OCLN (5A7)
YF-MA20378	Abfrontier	100 ug	EUR 363
Description: Mouse monoclonal to OCLN

Human Occludin (OCLN) Protein
20-abx654597	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Rat Occludin (OCLN) Protein
20-abx654599	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Rat OCLN shRNA Plasmid
20-abx986766	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human OCLN ELISA Kit
EHO0016	Abclonal	96Tests	EUR 521

Human OCLN ELISA Kit
ELA-E14928h	Lifescience Market	96 Tests	EUR 824

Goat OCLN ELISA Kit
EGTO0016	Abclonal	96Tests	EUR 521

Bovine OCLN ELISA Kit
EBO0016	Abclonal	96Tests	EUR 521

CHICKEN OCLN ELISA KIT
ECKO0016	Abclonal	96Tests	EUR 521

Canine OCLN ELISA Kit
ECO0016	Abclonal	96Tests	EUR 521

Anserini OCLN ELISA Kit
EAO0016	Abclonal	96Tests	EUR 521

Canine OCLN ELISA KIT
ELI-13288d	Lifescience Market	96 Tests	EUR 928

OCLN ELISA KIT|Human
EF005821	Lifescience Market	96 Tests	EUR 689

Porcine OCLN ELISA Kit
EPO0016	Abclonal	96Tests	EUR 521

Rat OCLN ELISA Kit
ERO0016	Abclonal	96Tests	EUR 521

Sheep OCLN ELISA Kit
ESO0016	Abclonal	96Tests	EUR 521

Monkey OCLN ELISA Kit
EMKO0016	Abclonal	96Tests	EUR 521

Mouse OCLN ELISA Kit
EMO0016	Abclonal	96Tests	EUR 521

Mouse Occludin (OCLN) Protein
20-abx068376	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-12 working days.

Human OCLN shRNA Plasmid
20-abx968922	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse OCLN shRNA Plasmid
20-abx971853	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

OCLN Recombinant Protein (Human)
RP022045	ABM	100 ug	Ask for price

OCLN Recombinant Protein (Rat)
RP215030	ABM	100 ug	Ask for price

pCMV-SPORT6-OCLN Plasmid
PVTB00550	Lifescience Market	2 ug	EUR 356

pLenti6/v5-OCLN Plasmid
PVTB00550-2b	Lifescience Market	2 ug	EUR 356

OCLN Recombinant Protein (Mouse)
RP155726	ABM	100 ug	Ask for price

Monoclonal OCLN Antibody (monoclonal) (M01), Clone: 1G7
APR17654G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human OCLN (monoclonal) (M01). The antibodies are raised in Mouse and are from clone 1G7. This antibody is applicable in WB and IF, IP, E

Chicken Occludin (OCLN) ELISA Kit
abx517212-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Dog Occludin (OCLN) ELISA Kit
abx517213-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Pig Occludin (OCLN) ELISA Kit
abx361109-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Occludin (OCLN) ELISA Kit
abx570647-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Mouse Occludin (OCLN) ELISA Kit
abx572435-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Guinea Pig OCLN ELISA Kit
EGO0016	Abclonal	96Tests	EUR 521

Mouse Ocln/ Occludin ELISA Kit
E1073Mo	Sunlong	1 Kit	EUR 632

Human OCLN/ Occludin ELISA Kit
E1819Hu	Sunlong	1 Kit	EUR 605

Human OCLN(Occludin) ELISA Kit
EH1674	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q16625 Alias: OCLN(Occludin)/BLCPMG
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Human Occludin, OCLN ELISA KIT
ELI-21396h	Lifescience Market	96 Tests	EUR 824

Chicken Occludin, OCLN ELISA KIT
ELI-22451c	Lifescience Market	96 Tests	EUR 928

Rat OCLN(Occludin) ELISA Kit
ER1206	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: Q6P6T5 Alias: OCLN/BLCPMG
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094 ng/ml

Mouse Occludin, Ocln ELISA KIT
ELI-44575m	Lifescience Market	96 Tests	EUR 865

Monkey OCLN(Occludin) ELISA Kit
EMK0112	FN Test	96T	EUR 567.6
Detection range: 0.156-10 ng/ml Alias: Occludin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Ape;Sensitivity: 0.094 ng/ml

Rat Occludin (OCLN) ELISA Kit
20-abx155925	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Occludin (OCLN) ELISA Kit
20-abx154483	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Occludin (OCLN) ELISA Kit
20-abx152580	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Occludin (OCLN) CLIA Kit
abx195254-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Occludin (OCLN) ELISA Kit
abx357187-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Occludin (OCLN) CLIA Kit
20-abx493554	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Occludin (OCLN) CLIA Kit
20-abx493555	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Occludin (OCLN) CLIA Kit
20-abx493556	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Occludin (OCLN) ELISA Kit
abx255868-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Monkey Occludin (OCLN) ELISA Kit
abx257872-96tests	Abbexa	96 tests	EUR 786
Shipped within 5-12 working days.

Human Occludin (OCLN) ELISA Kit
abx250971-96tests	Abbexa	96 tests	EUR 754
Shipped within 5-12 working days.

Rat Occludin (Ocln) ELISA kit
CSB-E17291r-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Occludin (Ocln) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Occludin (Ocln) ELISA kit
1-CSB-E17291r	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Occludin (Ocln) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Human Occludin(OCLN) ELISA kit
CSB-EL016263HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Occludin (OCLN) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Occludin(OCLN) ELISA kit
1-CSB-EL016263HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Occludin(OCLN) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

OCLN ORF Vector (Human) (pORF)
ORF007349	ABM	1.0 ug DNA	EUR 95

Ocln ORF Vector (Rat) (pORF)
ORF071678	ABM	1.0 ug DNA	EUR 506

Ocln ORF Vector (Mouse) (pORF)
ORF051910	ABM	1.0 ug DNA	EUR 506

Human Occludin (OCLN) ELISA Kit
SEC228Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

Human Occludin (OCLN) ELISA Kit
SEC228Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

Human Occludin (OCLN) ELISA Kit
SEC228Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

Human Occludin (OCLN) ELISA Kit
SEC228Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

Human Occludin (OCLN) ELISA Kit
4-SEC228Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Occludin elisa. Alternative names of the recognized antigen: Tight Junction Protein Occludin TM4 Minus
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Occludin (OCLN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Occludin (OCLN) ELISA Kit
SEC228Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Occludin (OCLN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Occludin (OCLN) ELISA Kit
SEC228Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Occludin (OCLN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Occludin (OCLN) ELISA Kit
SEC228Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Occludin (OCLN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Occludin (OCLN) ELISA Kit
SEC228Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Occludin (OCLN) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Occludin (OCLN) ELISA Kit
4-SEC228Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Occludin elisa. Alternative names of the recognized antigen: Tight Junction Protein Occludin TM4 Minus
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Occludin (OCLN) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Occludin (OCLN) ELISA Kit
SEC228Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

Rat Occludin (OCLN) ELISA Kit
SEC228Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

Rat Occludin (OCLN) ELISA Kit
SEC228Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

Rat Occludin (OCLN) ELISA Kit
SEC228Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Occludin (OCLN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Occludin (OCLN) in tissue homogenates, cell lysates and other biological fluids.

Rat Occludin (OCLN) ELISA Kit
4-SEC228Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Occludin elisa. Alternative names of the recognized antigen: Tight Junction Protein Occludin TM4 Minus
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Occludin (OCLN) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Occludin ELISA Kit (OCLN)
RK01985	Abclonal	96 Tests	EUR 605

Mouse Occludin ELISA Kit (OCLN)
RK03089	Abclonal	96 Tests	EUR 521

Rat Occludin ELISA Kit (OCLN)
RK03859	Abclonal	96 Tests	EUR 521

Human Occludin(OCLN)ELISA Kit
QY-E02189	Qayee Biotechnology	96T	EUR 413

Rat Occludin(OCLN)ELISA kit
QY-E10204	Qayee Biotechnology	96T	EUR 361

Mouse Occludin(OCLN)ELISA kit
QY-E21108	Qayee Biotechnology	96T	EUR 361

pECMV-Ocln-m-FLAG Plasmid
PVT15415	Lifescience Market	2 ug	EUR 325

OCLN ELISA Kit (Rat) (OKAN06300)
OKAN06300	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.123 ng/mL

OCLN ELISA Kit (Mouse) (OKAN06459)
OKAN06459	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.132 ng/mL

OCLN ELISA Kit (Human) (OKAN06498)
OKAN06498	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes an integral membrane protein that is required for cytokine-induced regulation of the tight junction paracellular permeability barrier. Mutations in this gene are thought to be a cause of band-like calcification with simplified gyration and polymicrogyria (BLC-PMG), an autosomal recessive neurologic disorder that is also known as pseudo-TORCH syndrome. Alternative splicing results in multiple transcript variants. A related pseudogene is present 1.5 Mb downstream on the q arm of chromosome 5.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

OCLN ELISA Kit (Rat) (OKCD02739)
OKCD02739	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. May be involved in the organization of actin in endothelial cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.123 ng/mL

OCLN ELISA Kit (Mouse) (OKCD02772)
OKCD02772	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: < 0.113 ng/mL

OCLN ELISA Kit (Human) (OKCD08049)
OKCD08049	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: OCLN is an integral membrane protein which is located at tight junctions. This protein may be involved in the formation and maintenance of the tight junction. The possibility of several alternatively spliced products has been suggested but the full nature of these products has not been described. This gene encodes an integral membrane protein which is located at tight junctions. This protein may be involved in the formation and maintenance of the tight junction. The possibility of several alternatively spliced products has been suggested but the full nature of these products has not been described. Publication Note: This RefSeq record includes a subset of the publications that are available for this gene. Please see the Entrez Gene record to access additional publications.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

OCLN ELISA Kit (Rat) (OKCA02244)
OKCA02244	Aviva Systems Biology	96 Wells	EUR 833
Description: Description of target: May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. May be involved in the organization of actin in endothelial cells.;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 6.25 pg/mL

OCLN ELISA Kit (Mouse) (OKEH07095)
OKEH07095	Aviva Systems Biology	96 Wells	EUR 779
Description: Description of target: May play a role in the formation and regulation of the tight junction (TJ) paracellular permeability barrier. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

OCLN ELISA Kit (Chicken) (OKEH08066)
OKEH08066	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Chicken;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078ng/mL

OCLN ELISA Kit (Dog) (OKEH08067)
OKEH08067	Aviva Systems Biology	96 Wells	EUR 1184
Description: Description of target: ;Species reactivity: Dog;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity:

ELISA kit for Human OCLN (Occludin)
ELK3078	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Occludin (OCLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Occludin (OCLN). N Show more
Description: A sandwich ELISA kit for detection of Occludin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat OCLN (Occludin)
ELK6134	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Occludin (OCLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Occludin (OCLN). N Show more
Description: A sandwich ELISA kit for detection of Occludin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse OCLN (Occludin)
ELK6145	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Occludin (OCLN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Occludin (OCLN). N Show more
Description: A sandwich ELISA kit for detection of Occludin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

OCLN sgRNA CRISPR Lentivector set (Human)
K1475401	ABM	3 x 1.0 ug	EUR 339

Ocln sgRNA CRISPR Lentivector set (Mouse)
K4359401	ABM	3 x 1.0 ug	EUR 339

CLIA kit for Human OCLN (Occludin)
E-CL-H0720	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's OCLN CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human OCLN . Standards or samples are added to the micro CLIA plate wells and combined with the Show more
Description: A sandwich CLIA kit for quantitative measurement of Human OCLN (Occludin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat OCLN (Occludin)
E-EL-R2503	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's OCLN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Rat OCLN. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Rat OCLN (Occludin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human OCLN (Occludin)
E-EL-H1073	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's OCLN ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human OCLN. Standards or samples are added to the micro ELISA plate wells and combined with th Show more
Description: A sandwich ELISA kit for quantitative measurement of Human OCLN (Occludin) in samples from Serum, Plasma, Cell supernatant

Ocln sgRNA CRISPR Lentivector set (Rat)
K7622601	ABM	3 x 1.0 ug	EUR 339

Ocln ELISA Kit| Mouse Occludin ELISA Kit
EF015742	Lifescience Market	96 Tests	EUR 689

OCLN ELISA Kit| Rat Occludin ELISA Kit
EF017927	Lifescience Market	96 Tests	EUR 689

OCLN ELISA Kit| chicken Occludin ELISA Kit
EF012441	Lifescience Market	96 Tests	EUR 689

OCLN ELISA Kit| Monkey Occludin ELISA Kit
EF012772	Lifescience Market	96 Tests	EUR 689

OCLN sgRNA CRISPR Lentivector (Human) (Target 1)
K1475402	ABM	1.0 ug DNA	EUR 154

OCLN sgRNA CRISPR Lentivector (Human) (Target 2)
K1475403	ABM	1.0 ug DNA	EUR 154

OCLN Rabbit Polyclonal Antibody