RXFP1 Rabbit Polyclonal Antibody

RXFP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

RXFP1 Polyclonal Antibody
ABP60284-003ml	Abbkine	0.03ml	EUR 158
Immunogen information: Synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320 Applications tips:
Description: A polyclonal antibody for detection of RXFP1 from Human, Mouse, Rat. This RXFP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320

RXFP1 Polyclonal Antibody
ABP60284-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320 Applications tips:
Description: A polyclonal antibody for detection of RXFP1 from Human, Mouse, Rat. This RXFP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320

RXFP1 Polyclonal Antibody
ABP60284-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320 Applications tips:
Description: A polyclonal antibody for detection of RXFP1 from Human, Mouse, Rat. This RXFP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320

RXFP1 Rabbit pAb
A7127-100ul	Abclonal	100 ul	EUR 308

RXFP1 Rabbit pAb
A7127-200ul	Abclonal	200 ul	EUR 459

RXFP1 Rabbit pAb
A7127-20ul	Abclonal	20 ul	EUR 183

RXFP1 Rabbit pAb
A7127-50ul	Abclonal	50 ul	EUR 223

RXFP1 Antibody
ABD10265	Lifescience Market	100 ug	EUR 438

RXFP1 Antibody
44621-100ul	SAB	100ul	EUR 252

RXFP1 Antibody
44621-50ul	SAB	50ul	EUR 187

RXFP1 Antibody
1-CSB-PA875715LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

RXFP1 Antibody
DF10265	Affbiotech	200ul	EUR 304
Description: RXFP1 Antibody detects endogenous levels of total RXFP1.

Rabbit RXFP1 ELISA Kit
ERTR0126	Abclonal	96Tests	EUR 521

Polyclonal RXFP1/ LGR7 Antibody (C-Terminus)
AMM07700G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXFP1/ LGR7 (C-Terminus). This antibody is tested and proven to work in the following applications:

RXFP1 Conjugated Antibody
C44621	SAB	100ul	EUR 397

Anti-RXFP1 antibody
STJ117834	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.

Anti-RXFP1 antibody
STJ192791	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to RXFP1

Rxfp1/ Rat Rxfp1 ELISA Kit
ELI-18418r	Lifescience Market	96 Tests	EUR 886

RXFP1 siRNA
20-abx904749	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RXFP1 siRNA
20-abx932314	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RXFP1 siRNA
20-abx932315	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

RXFP1 Antibody, HRP conjugated
1-CSB-PA875715LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

RXFP1 Antibody, FITC conjugated
1-CSB-PA875715LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

RXFP1 Antibody, Biotin conjugated
1-CSB-PA875715LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

RXFP1 cloning plasmid
CSB-CL875715HU-10ug	Cusabio	10ug	EUR 474
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2274 Sequence: atgacatctggttctgtcttcttctacatcttaatttttggaaaatatttttctcatgggggtggacaggatgtcaagtgctcccttggctatttcccctgtgggaacatcacaaagtgcttgcctcagctcctgcactgtaacggtgtggacgactgcgggaatcaggccgatg Show more
Description: A cloning plasmid for the RXFP1 gene.

RXFP1 Blocking Peptide
DF10265-BP	Affbiotech	1mg	EUR 195

Rat RXFP1 shRNA Plasmid
20-abx988736	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Mouse RXFP1 shRNA Plasmid
20-abx983833	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human RXFP1 ELISA Kit
EHR0126	Abclonal	96Tests	EUR 521

Goat RXFP1 ELISA Kit
EGTR0126	Abclonal	96Tests	EUR 521

Bovine RXFP1 ELISA Kit
EBR0126	Abclonal	96Tests	EUR 521

Anserini RXFP1 ELISA Kit
EAR0126	Abclonal	96Tests	EUR 521

Canine RXFP1 ELISA Kit
ECR0126	Abclonal	96Tests	EUR 521

RXFP1 ELISA KIT|Human
EF007150	Lifescience Market	96 Tests	EUR 689

Porcine RXFP1 ELISA Kit
EPR0126	Abclonal	96Tests	EUR 521

Rat RXFP1 ELISA Kit
ERR0126	Abclonal	96Tests	EUR 521

Mouse RXFP1 ELISA Kit
EMR0126	Abclonal	96Tests	EUR 521

Human RXFP1 shRNA Plasmid
20-abx961780	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

RXFP1 Recombinant Protein (Human)
RP043066	ABM	100 ug	Ask for price

RXFP1 Recombinant Protein (Rat)
RP227312	ABM	100 ug	Ask for price

RXFP1 Recombinant Protein (Mouse)
RP169733	ABM	100 ug	Ask for price

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human)
4-PAB456Hu01	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro260~Met409) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1)

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human)
4-PAB456Hu02	Cloud-Clone	EUR 239.00 EUR 2391.00 EUR 598.00 EUR 299.00 EUR 211.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro110~Ala259) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1)

Guinea Pig RXFP1 ELISA Kit
EGR0126	Abclonal	96Tests	EUR 521

Rxfp1 ORF Vector (Mouse) (pORF)
ORF056579	ABM	1.0 ug DNA	EUR 506

Rxfp1 ORF Vector (Rat) (pORF)
ORF075772	ABM	1.0 ug DNA	EUR 506

RXFP1 ORF Vector (Human) (pORF)
ORF014356	ABM	1.0 ug DNA	EUR 354

RXFP1 ELISA Kit (Human) (OKEI00271)
OKEI00271	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL

RXFP1 ELISA Kit (Mouse) (OKEI00537)
OKEI00537	Aviva Systems Biology	96 Wells	EUR 767
Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL

RXFP1 ELISA Kit (Rat) (OKWB00369)
OKWB00369	Aviva Systems Biology	96 Wells	EUR 572
Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC
4-PAB456Hu01-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro260~Met409) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Biotinylated
4-PAB456Hu01-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro260~Met409) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Biotin.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Cy3
4-PAB456Hu01-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro260~Met409) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Cy3.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), FITC
4-PAB456Hu01-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro260~Met409) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with FITC.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), HRP
4-PAB456Hu01-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro260~Met409) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with HRP.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), PE
4-PAB456Hu01-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro260~Met409) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with PE.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC
4-PAB456Hu02-APC	Cloud-Clone	EUR 333.00 EUR 3113.00 EUR 872.00 EUR 423.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro110~Ala259) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Biotinylated
4-PAB456Hu02-Biotin	Cloud-Clone	EUR 303.00 EUR 2341.00 EUR 697.00 EUR 369.00 EUR 216.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro110~Ala259) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Biotin.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Cy3
4-PAB456Hu02-Cy3	Cloud-Clone	EUR 403.00 EUR 4109.00 EUR 1121.00 EUR 523.00 EUR 245.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro110~Ala259) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Cy3.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), FITC
4-PAB456Hu02-FITC	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro110~Ala259) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with FITC.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), HRP
4-PAB456Hu02-HRP	Cloud-Clone	EUR 305.00 EUR 2714.00 EUR 772.00 EUR 383.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro110~Ala259) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with HRP.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), PE
4-PAB456Hu02-PE	Cloud-Clone	EUR 287.00 EUR 2510.00 EUR 717.00 EUR 359.00 EUR 192.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro110~Ala259) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with PE.

Rabbit Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) ELISA Kit
abx362225-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

RXFP1 sgRNA CRISPR Lentivector set (Human)
K2080101	ABM	3 x 1.0 ug	EUR 339

Rxfp1 sgRNA CRISPR Lentivector set (Mouse)
K3351801	ABM	3 x 1.0 ug	EUR 339

Rxfp1 sgRNA CRISPR Lentivector set (Rat)
K7377201	ABM	3 x 1.0 ug	EUR 339

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC-Cy7
4-PAB456Hu01-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro260~Met409) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC-Cy7.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC-Cy7
4-PAB456Hu02-APC-Cy7	Cloud-Clone	EUR 547.00 EUR 6106.00 EUR 1624.00 EUR 727.00 EUR 310.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: RXFP1 (Pro110~Ala259) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC-Cy7.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
abx122948-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
20-abx104448	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
20-abx104449	Abbexa	EUR 411.00 EUR 133.00 EUR 1149.00 EUR 565.00 EUR 314.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
20-abx218407	Abbexa	EUR 425.00 EUR 342.00	100 ug 50 ug
Shipped within 5-10 working days.

Mouse Relaxin receptor 1, Rxfp1 ELISA KIT
ELI-29419m	Lifescience Market	96 Tests	EUR 865

Human Relaxin receptor 1, RXFP1 ELISA KIT
ELI-41553h	Lifescience Market	96 Tests	EUR 824

RXFP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2080102	ABM	1.0 ug DNA	EUR 154

RXFP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K2080103	ABM	1.0 ug DNA	EUR 154

RXFP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K2080104	ABM	1.0 ug DNA	EUR 154

Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3351802	ABM	1.0 ug DNA	EUR 154

Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3351803	ABM	1.0 ug DNA	EUR 154

Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3351804	ABM	1.0 ug DNA	EUR 154

Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7377202	ABM	1.0 ug DNA	EUR 154

Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7377203	ABM	1.0 ug DNA	EUR 154

Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7377204	ABM	1.0 ug DNA	EUR 154

RXFP1 Protein Vector (Human) (pPB-C-His)
PV057421	ABM	500 ng	EUR 481

RXFP1 Protein Vector (Human) (pPB-N-His)
PV057422	ABM	500 ng	EUR 481

RXFP1 Protein Vector (Human) (pPM-C-HA)
PV057423	ABM	500 ng	EUR 481

RXFP1 Protein Vector (Human) (pPM-C-His)
PV057424	ABM	500 ng	EUR 481

RXFP1 Protein Vector (Rat) (pPB-C-His)
PV303086	ABM	500 ng	EUR 1166

RXFP1 Protein Vector (Rat) (pPB-N-His)
PV303087	ABM	500 ng	EUR 1166

RXFP1 Protein Vector (Rat) (pPM-C-HA)
PV303088	ABM	500 ng	EUR 1166

RXFP1 Protein Vector (Rat) (pPM-C-His)
PV303089	ABM	500 ng	EUR 1166

RXFP1 Protein Vector (Mouse) (pPB-C-His)
PV226314	ABM	500 ng	EUR 1065

RXFP1 Rabbit Polyclonal Antibody