RXFP1 Rabbit Polyclonal Antibody

RXFP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RXFP1 Polyclonal Antibody
    ABP60284-003ml 0.03ml
    EUR 158
    • Immunogen information: Synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
    • Applications tips:
    Description: A polyclonal antibody for detection of RXFP1 from Human, Mouse, Rat. This RXFP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
    RXFP1 Polyclonal Antibody
    ABP60284-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
    • Applications tips:
    Description: A polyclonal antibody for detection of RXFP1 from Human, Mouse, Rat. This RXFP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
    RXFP1 Polyclonal Antibody
    ABP60284-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
    • Applications tips:
    Description: A polyclonal antibody for detection of RXFP1 from Human, Mouse, Rat. This RXFP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human RXFP1 protein at amino acid sequence of 240-320
    RXFP1 Rabbit pAb
    A7127-100ul 100 ul
    EUR 308
    RXFP1 Rabbit pAb
    A7127-200ul 200 ul
    EUR 459
    RXFP1 Rabbit pAb
    A7127-20ul 20 ul
    EUR 183
    RXFP1 Rabbit pAb
    A7127-50ul 50 ul
    EUR 223
    RXFP1 Antibody
    ABD10265 100 ug
    EUR 438
    RXFP1 Antibody
    44621-100ul 100ul
    EUR 252
    RXFP1 Antibody
    44621-50ul 50ul
    EUR 187
    RXFP1 Antibody
    1-CSB-PA875715LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
    RXFP1 Antibody
    DF10265 200ul
    EUR 304
    Description: RXFP1 Antibody detects endogenous levels of total RXFP1.
    Rabbit RXFP1 ELISA Kit
    ERTR0126 96Tests
    EUR 521
    Polyclonal RXFP1/ LGR7 Antibody (C-Terminus)
    AMM07700G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RXFP1/ LGR7 (C-Terminus). This antibody is tested and proven to work in the following applications:
    RXFP1 Conjugated Antibody
    C44621 100ul
    EUR 397
    Anti-RXFP1 antibody
    STJ117834 100 µl
    EUR 277
    Description: This gene encodes a member of the leucine-rich repeat-containing subgroup of the G protein-coupled 7-transmembrane receptor superfamily. The encoded protein plays a critical role in sperm motility, pregnancy and parturition as a receptor for the protein hormone relaxin. Decreased expression of this gene may play a role in endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene.
    Anti-RXFP1 antibody
    STJ192791 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RXFP1
    Rxfp1/ Rat Rxfp1 ELISA Kit
    ELI-18418r 96 Tests
    EUR 886
    RXFP1 siRNA
    20-abx904749
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RXFP1 siRNA
    20-abx932314
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RXFP1 siRNA
    20-abx932315
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    RXFP1 Antibody, HRP conjugated
    1-CSB-PA875715LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    RXFP1 Antibody, FITC conjugated
    1-CSB-PA875715LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    RXFP1 Antibody, Biotin conjugated
    1-CSB-PA875715LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RXFP1. Recognizes RXFP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    RXFP1 cloning plasmid
    CSB-CL875715HU-10ug 10ug
    EUR 474
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2274
    • Sequence: atgacatctggttctgtcttcttctacatcttaatttttggaaaatatttttctcatgggggtggacaggatgtcaagtgctcccttggctatttcccctgtgggaacatcacaaagtgcttgcctcagctcctgcactgtaacggtgtggacgactgcgggaatcaggccgatg
    • Show more
    Description: A cloning plasmid for the RXFP1 gene.
    RXFP1 Blocking Peptide
    DF10265-BP 1mg
    EUR 195
    Rat RXFP1 shRNA Plasmid
    20-abx988736
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse RXFP1 shRNA Plasmid
    20-abx983833
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human RXFP1 ELISA Kit
    EHR0126 96Tests
    EUR 521
    Goat RXFP1 ELISA Kit
    EGTR0126 96Tests
    EUR 521
    Bovine RXFP1 ELISA Kit
    EBR0126 96Tests
    EUR 521
    Anserini RXFP1 ELISA Kit
    EAR0126 96Tests
    EUR 521
    Canine RXFP1 ELISA Kit
    ECR0126 96Tests
    EUR 521
    RXFP1 ELISA KIT|Human
    EF007150 96 Tests
    EUR 689
    Porcine RXFP1 ELISA Kit
    EPR0126 96Tests
    EUR 521
    Rat RXFP1 ELISA Kit
    ERR0126 96Tests
    EUR 521
    Mouse RXFP1 ELISA Kit
    EMR0126 96Tests
    EUR 521
    Human RXFP1 shRNA Plasmid
    20-abx961780
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    RXFP1 Recombinant Protein (Human)
    RP043066 100 ug Ask for price
    RXFP1 Recombinant Protein (Rat)
    RP227312 100 ug Ask for price
    RXFP1 Recombinant Protein (Mouse)
    RP169733 100 ug Ask for price
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human)
    4-PAB456Hu01
    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro260~Met409)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1)
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human)
    4-PAB456Hu02
    • EUR 239.00
    • EUR 2391.00
    • EUR 598.00
    • EUR 299.00
    • EUR 211.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1)
    Guinea Pig RXFP1 ELISA Kit
    EGR0126 96Tests
    EUR 521
    Rxfp1 ORF Vector (Mouse) (pORF)
    ORF056579 1.0 ug DNA
    EUR 506
    Rxfp1 ORF Vector (Rat) (pORF)
    ORF075772 1.0 ug DNA
    EUR 506
    RXFP1 ORF Vector (Human) (pORF)
    ORF014356 1.0 ug DNA
    EUR 354
    RXFP1 ELISA Kit (Human) (OKEI00271)
    OKEI00271 96 Wells
    EUR 767
    Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL
    RXFP1 ELISA Kit (Mouse) (OKEI00537)
    OKEI00537 96 Wells
    EUR 767
    Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 9.375 pg/mL
    RXFP1 ELISA Kit (Rat) (OKWB00369)
    OKWB00369 96 Wells
    EUR 572
    Description: Description of target: Receptor for relaxins. The activity of this receptor is mediated by G proteins leading to stimulation of adenylate cyclase and an increase of cAMP. Binding of the ligand may also activate a tyrosine kinase pathway that inhibits the activity of a phosphodiesterase that degrades cAMP ;Species reactivity: Rat;Application: ;Assay info: Assay Type: Quantitative Sandwich ELISA;Sensitivity: 9.4 pg/mL
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC
    4-PAB456Hu01-APC
    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro260~Met409)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Biotinylated
    4-PAB456Hu01-Biotin
    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro260~Met409)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Biotin.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Cy3
    4-PAB456Hu01-Cy3
    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro260~Met409)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Cy3.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), FITC
    4-PAB456Hu01-FITC
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro260~Met409)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with FITC.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), HRP
    4-PAB456Hu01-HRP
    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro260~Met409)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with HRP.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), PE
    4-PAB456Hu01-PE
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro260~Met409)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with PE.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC
    4-PAB456Hu02-APC
    • EUR 333.00
    • EUR 3113.00
    • EUR 872.00
    • EUR 423.00
    • EUR 215.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Biotinylated
    4-PAB456Hu02-Biotin
    • EUR 303.00
    • EUR 2341.00
    • EUR 697.00
    • EUR 369.00
    • EUR 216.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Biotin.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), Cy3
    4-PAB456Hu02-Cy3
    • EUR 403.00
    • EUR 4109.00
    • EUR 1121.00
    • EUR 523.00
    • EUR 245.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with Cy3.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), FITC
    4-PAB456Hu02-FITC
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with FITC.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), HRP
    4-PAB456Hu02-HRP
    • EUR 305.00
    • EUR 2714.00
    • EUR 772.00
    • EUR 383.00
    • EUR 203.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with HRP.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), PE
    4-PAB456Hu02-PE
    • EUR 287.00
    • EUR 2510.00
    • EUR 717.00
    • EUR 359.00
    • EUR 192.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with PE.
    Rabbit Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) ELISA Kit
    abx362225-96tests 96 tests
    EUR 825
    • Shipped within 5-12 working days.
    RXFP1 sgRNA CRISPR Lentivector set (Human)
    K2080101 3 x 1.0 ug
    EUR 339
    Rxfp1 sgRNA CRISPR Lentivector set (Mouse)
    K3351801 3 x 1.0 ug
    EUR 339
    Rxfp1 sgRNA CRISPR Lentivector set (Rat)
    K7377201 3 x 1.0 ug
    EUR 339
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC-Cy7
    4-PAB456Hu01-APC-Cy7
    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro260~Met409)
    • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC-Cy7.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Polyclonal Antibody (Human), APC-Cy7
    4-PAB456Hu02-APC-Cy7
    • EUR 547.00
    • EUR 6106.00
    • EUR 1624.00
    • EUR 727.00
    • EUR 310.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: RXFP1 (Pro110~Ala259)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1). This antibody is labeled with APC-Cy7.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
    abx122948-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
    20-abx104448
    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
    20-abx104449
    • EUR 411.00
    • EUR 133.00
    • EUR 1149.00
    • EUR 565.00
    • EUR 314.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    Relaxin/Insulin Like Family Peptide Receptor 1 (RXFP1) Antibody
    20-abx218407
    • EUR 425.00
    • EUR 342.00
    • 100 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Mouse Relaxin receptor 1, Rxfp1 ELISA KIT
    ELI-29419m 96 Tests
    EUR 865
    Human Relaxin receptor 1, RXFP1 ELISA KIT
    ELI-41553h 96 Tests
    EUR 824
    RXFP1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K2080102 1.0 ug DNA
    EUR 154
    RXFP1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K2080103 1.0 ug DNA
    EUR 154
    RXFP1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K2080104 1.0 ug DNA
    EUR 154
    Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3351802 1.0 ug DNA
    EUR 154
    Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3351803 1.0 ug DNA
    EUR 154
    Rxfp1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3351804 1.0 ug DNA
    EUR 154
    Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7377202 1.0 ug DNA
    EUR 154
    Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7377203 1.0 ug DNA
    EUR 154
    Rxfp1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7377204 1.0 ug DNA
    EUR 154
    RXFP1 Protein Vector (Human) (pPB-C-His)
    PV057421 500 ng
    EUR 481
    RXFP1 Protein Vector (Human) (pPB-N-His)
    PV057422 500 ng
    EUR 481
    RXFP1 Protein Vector (Human) (pPM-C-HA)
    PV057423 500 ng
    EUR 481
    RXFP1 Protein Vector (Human) (pPM-C-His)
    PV057424 500 ng
    EUR 481
    RXFP1 Protein Vector (Rat) (pPB-C-His)
    PV303086 500 ng
    EUR 1166
    RXFP1 Protein Vector (Rat) (pPB-N-His)
    PV303087 500 ng
    EUR 1166
    RXFP1 Protein Vector (Rat) (pPM-C-HA)
    PV303088 500 ng
    EUR 1166
    RXFP1 Protein Vector (Rat) (pPM-C-His)
    PV303089 500 ng
    EUR 1166
    RXFP1 Protein Vector (Mouse) (pPB-C-His)
    PV226314 500 ng
    EUR 1065

    RXFP1 Rabbit Polyclonal Antibody