RBMS3 Rabbit Polyclonal Antibody

RBMS3 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RBMS3 Polyclonal Antibody

    ES11856-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against RBMS3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    RBMS3 Polyclonal Antibody

    ES11856-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against RBMS3 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    RBMS3 Rabbit pAb

    A17142-100ul 100 ul
    EUR 308

    RBMS3 Rabbit pAb

    A17142-200ul 200 ul
    EUR 459

    RBMS3 Rabbit pAb

    A17142-20ul 20 ul
    EUR 183

    RBMS3 Rabbit pAb

    A17142-50ul 50 ul
    EUR 223

    RBMS3 antibody

    70R-1317 100 ug
    EUR 377
    Description: Rabbit polyclonal RBMS3 antibody raised against the N terminal of RBMS3

    RBMS3 antibody

    70R-1318 100 ug
    EUR 377
    Description: Rabbit polyclonal RBMS3 antibody raised against the C terminal of RBMS3

    RBMS3 Antibody

    37025-100ul 100ul
    EUR 252

    RBMS3 Antibody

    1-CSB-PA998451
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:10000, WB:1:1000-1:5000, IHC:1:50-1:100

    RBMS3 Antibody

    1-CSB-PA761548LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:200-1:500

    RBMS3 Antibody

    DF8599 200ul
    EUR 304
    Description: RBMS3 Antibody detects endogenous levels of total RBMS3.

    RBMS3 Antibody

    1-CSB-PA579163
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

    RBMS3 antibody

    70R-4798 50 ug
    EUR 467
    Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3

    RBMS3 antibody

    70R-4803 50 ug
    EUR 467
    Description: Rabbit polyclonal RBMS3 antibody raised against the middle region of RBMS3

    RBMS3 Antibody

    ABD8599 100 ug
    EUR 438

    RBMS3 Polyclonal Antibody, HRP Conjugated

    A68984 100 ?g
    EUR 628.55
    Description: The best epigenetics products

    RBMS3 Polyclonal Antibody, FITC Conjugated

    A68985 100 ?g
    EUR 628.55
    Description: kits suitable for this type of research

    RBMS3 Polyclonal Antibody, Biotin Conjugated

    A68986 100 ?g
    EUR 628.55
    Description: fast delivery possible

    Anti-RBMS3 Antibody

    A12416 100ul
    EUR 397
    Description: Rabbit Polyclonal RBMS3 Antibody. Validated in WB and tested in Human, Mouse.

    Anti-RBMS3 Antibody

    A12416-3 100ug/vial
    EUR 334

    Anti-RBMS3 antibody

    STJ119365 100 µl
    EUR 277

    Anti-RBMS3 antibody

    STJ193014 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RBMS3

    RBMS3 siRNA

    20-abx931100
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBMS3 siRNA

    20-abx931101
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBMS3 Antibody, HRP conjugated

    1-CSB-PA761548LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    RBMS3 Antibody, FITC conjugated

    1-CSB-PA761548LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    RBMS3 Antibody, Biotin conjugated

    1-CSB-PA761548LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS3. Recognizes RBMS3 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    RBMS3 Blocking Peptide

    33R-3651 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1317

    RBMS3 Blocking Peptide

    33R-8991 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-1318

    RBMS3 Blocking Peptide

    33R-9391 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4798

    RBMS3 Blocking Peptide

    33R-7382 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS3 antibody, catalog no. 70R-4803

    RBMS3 Blocking Peptide

    DF8599-BP 1mg
    EUR 195

    RBMS3 cloning plasmid

    CSB-CL761548HU-10ug 10ug
    EUR 474
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1302
    • Sequence: atgggcaaacgcctggatcagccacaaatgtacccccagtacacttactactatcctcattatctccaaaccaagcagtcctatgcaccagctccccaccccatggctcctcccagccccagcacaaacagcagcagcaacaacagcagcaacaacagcagcggggaacagttga
    • Show more
    Description: A cloning plasmid for the RBMS3 gene.

    Anti-RBMS3 (3B11)

    YF-MA18198 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS3

    Mouse Rbms3 ELISA KIT

    ELI-52240m 96 Tests
    EUR 865

    Human RBMS3 shRNA Plasmid

    20-abx959069
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse RBMS3 shRNA Plasmid

    20-abx980489
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human RBMS3 ELISA KIT

    ELI-39189h 96 Tests
    EUR 824

    RBMS3 Recombinant Protein (Human)

    RP042793 100 ug Ask for price

    RBMS3 Recombinant Protein (Mouse)

    RP167261 100 ug Ask for price

    RBMS3 Recombinant Protein (Mouse)

    RP167264 100 ug Ask for price

    RBMS3 Recombinant Protein (Mouse)

    RP167267 100 ug Ask for price

    RBMS3 Recombinant Protein (Mouse)

    RP167270 100 ug Ask for price

    RBMS3 Recombinant Protein (Mouse)

    RP167273 100 ug Ask for price

    RBMS3 Recombinant Protein (Mouse)

    RP167276 100 ug Ask for price

    RBMS3 ORF Vector (Human) (pORF)

    ORF014265 1.0 ug DNA
    EUR 354

    Rbms3 ORF Vector (Mouse) (pORF)

    ORF055755 1.0 ug DNA
    EUR 506

    Rbms3 ORF Vector (Mouse) (pORF)

    ORF055756 1.0 ug DNA
    EUR 506

    Rbms3 ORF Vector (Mouse) (pORF)

    ORF055757 1.0 ug DNA
    EUR 506

    Rbms3 ORF Vector (Mouse) (pORF)

    ORF055758 1.0 ug DNA
    EUR 506

    Rbms3 ORF Vector (Mouse) (pORF)

    ORF055759 1.0 ug DNA
    EUR 506

    Rbms3 ORF Vector (Mouse) (pORF)

    ORF055760 1.0 ug DNA
    EUR 506

    RBMS3 sgRNA CRISPR Lentivector set (Human)

    K1796701 3 x 1.0 ug
    EUR 339

    Rbms3 sgRNA CRISPR Lentivector set (Mouse)

    K4029901 3 x 1.0 ug
    EUR 339

    RBMS3-AS1 ORF Vector (Human) (pORF)

    ORF028771 1.0 ug DNA Ask for price

    RBMS3-AS2 ORF Vector (Human) (pORF)

    ORF028772 1.0 ug DNA Ask for price

    RBMS3-AS3 ORF Vector (Human) (pORF)

    ORF028773 1.0 ug DNA Ask for price

    RBMS3 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1796702 1.0 ug DNA
    EUR 154

    RBMS3 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1796703 1.0 ug DNA
    EUR 154

    RBMS3 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1796704 1.0 ug DNA
    EUR 154

    Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4029902 1.0 ug DNA
    EUR 154

    Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4029903 1.0 ug DNA
    EUR 154

    Rbms3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4029904 1.0 ug DNA
    EUR 154

    RBMS3 Protein Vector (Human) (pPB-C-His)

    PV057057 500 ng
    EUR 481

    RBMS3 Protein Vector (Human) (pPB-N-His)

    PV057058 500 ng
    EUR 481

    RBMS3 Protein Vector (Human) (pPM-C-HA)

    PV057059 500 ng
    EUR 481

    RBMS3 Protein Vector (Human) (pPM-C-His)

    PV057060 500 ng
    EUR 481

    RBMS3 Protein Vector (Mouse) (pPB-C-His)

    PV223018 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-N-His)

    PV223019 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-HA)

    PV223020 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-His)

    PV223021 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-C-His)

    PV223022 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-N-His)

    PV223023 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-HA)

    PV223024 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-His)

    PV223025 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-C-His)

    PV223026 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-N-His)

    PV223027 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-HA)

    PV223028 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-His)

    PV223029 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-C-His)

    PV223030 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-N-His)

    PV223031 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-HA)

    PV223032 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-His)

    PV223033 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-C-His)

    PV223034 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-N-His)

    PV223035 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-HA)

    PV223036 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-His)

    PV223037 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-C-His)

    PV223038 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPB-N-His)

    PV223039 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-HA)

    PV223040 500 ng
    EUR 603

    RBMS3 Protein Vector (Mouse) (pPM-C-His)

    PV223041 500 ng
    EUR 603

    Rbms3 3'UTR Luciferase Stable Cell Line

    TU117641 1.0 ml Ask for price

    Rbms3 3'UTR GFP Stable Cell Line

    TU167641 1.0 ml Ask for price

    RBMS3 3'UTR GFP Stable Cell Line

    TU069623 1.0 ml
    EUR 1394

    RBMS3 3'UTR Luciferase Stable Cell Line

    TU019623 1.0 ml
    EUR 1394

    RBMS3 Rabbit Polyclonal Antibody