MOAP1 Rabbit Polyclonal Antibody

MOAP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

MOAP1 Polyclonal Antibody
ABP59300-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein Applications tips:
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein

MOAP1 Polyclonal Antibody
ABP59300-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein Applications tips:
Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein

MOAP1 Polyclonal Antibody
ES11803-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against MOAP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOAP1 Polyclonal Antibody
ES11803-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against MOAP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

MOAP1 Rabbit pAb
A12599-100ul	Abclonal	100 ul	EUR 308

MOAP1 Rabbit pAb
A12599-200ul	Abclonal	200 ul	EUR 459

MOAP1 Rabbit pAb
A12599-20ul	Abclonal	20 ul	EUR 183

MOAP1 Rabbit pAb
A12599-50ul	Abclonal	50 ul	EUR 223

MOAP1 Rabbit pAb
A5759-100ul	Abclonal	100 ul	EUR 308

MOAP1 Rabbit pAb
A5759-200ul	Abclonal	200 ul	EUR 459

MOAP1 Rabbit pAb
A5759-20ul	Abclonal	20 ul	EUR 183

MOAP1 Rabbit pAb
A5759-50ul	Abclonal	50 ul	EUR 223

MOAP1 Polyclonal Conjugated Antibody
C27726	SAB	100ul	EUR 397

MOAP1 Polyclonal Conjugated Antibody
C30664	SAB	100ul	EUR 397

MOAP1 Antibody
1-CSB-PA014693ESR2HU	Cusabio	EUR 222.00 EUR 335.00	100ul 50ul
Form: Liquid Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MOAP1. Recognizes MOAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA

Polyclonal MOAP1 / MAP1 Antibody (Internal)
APR02274G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOAP1 / MAP1 (Internal). This antibody is tested and proven to work in the following applications:

Anti-MOAP1 antibody
STJ28326	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.

Anti-MOAP1 antibody
STJ114473	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.

Anti-MOAP1 antibody
STJ192961	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to MOAP1

MOAP1 siRNA
20-abx924354	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

MOAP1 siRNA
20-abx924355	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Modulator of apoptosis 1 (MOAP1) polyclonal antibody
ABP-PAB-10271	Allele Biotech	100 ug	Ask for price
Product line: Apoptosis Brand:

MOAP1 cloning plasmid
CSB-CL014693HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1056 Sequence: atgactttgaggcttttagaagactggtgcagggggatggacatgaaccctcggaaagcgctattgattgccggcatctcccagagctgcagtgtggcagaaatcgaggaggctctgcaggctggtttagctcccttgggggagtacagactgcttggaaggatgttcaggaggg Show more
Description: A cloning plasmid for the MOAP1 gene.

pCMV-SPORT6-MOAP1
PVT13194	Lifescience Market	2 ug	EUR 391

MOAP1 protein (His tag)
80R-3537	Fitzgerald	100 ug	EUR 424
Description: Purified recombinant MOAP1 protein (His tag)

MOAP1 ELISA KIT|Human
EF005290	Lifescience Market	96 Tests	EUR 689

Mouse MOAP1 shRNA Plasmid
20-abx975258	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human MOAP1 shRNA Plasmid
20-abx961927	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

MOAP1 Recombinant Protein (Human)
RP019669	ABM	100 ug	Ask for price

MOAP1 Recombinant Protein (Mouse)
RP151040	ABM	100 ug	Ask for price

MOAP1 Recombinant Protein (Mouse)
RP151043	ABM	100 ug	Ask for price

MOAP1 Recombinant Protein (Rat)
RP212006	ABM	100 ug	Ask for price

Modulator of Apoptosis 1 (MOAP1) Antibody
20-abx006312	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Modulator of Apoptosis 1 (MOAP1) Antibody
20-abx321726	Abbexa	EUR 300.00 EUR 244.00	100 ul 50 ul
Shipped within 5-10 working days.

Monoclonal MOAP1 Antibody (monoclonal) (M01), Clone: 4A11
AMM03806G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human MOAP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A11. This antibody is applicable in WB, E

Moap1 ORF Vector (Rat) (pORF)
ORF070670	ABM	1.0 ug DNA	EUR 506

MOAP1 ORF Vector (Human) (pORF)
ORF006557	ABM	1.0 ug DNA	EUR 95

Moap1 ORF Vector (Mouse) (pORF)
ORF050348	ABM	1.0 ug DNA	EUR 506

Moap1 ORF Vector (Mouse) (pORF)
ORF050349	ABM	1.0 ug DNA	EUR 506

Rabbit Anti-Mouse modulator of apoptosis 1 (MOAP1) IgG (aff pure)
AB-23039-A	Alpha Diagnostics	100ug	EUR 482

Human Modulator of apoptosis 1 (MOAP1)
1-CSB-EP014693HU	Cusabio	EUR 380.00 EUR 214.00 EUR 1309.00 EUR 560.00 EUR 873.00 EUR 262.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 66.5 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Modulator of apoptosis 1(MOAP1) expressed in E.coli

Moap1 sgRNA CRISPR Lentivector set (Rat)
K7145501	ABM	3 x 1.0 ug	EUR 339

MOAP1 sgRNA CRISPR Lentivector set (Human)
K1314501	ABM	3 x 1.0 ug	EUR 339

Moap1 sgRNA CRISPR Lentivector set (Mouse)
K3558001	ABM	3 x 1.0 ug	EUR 339

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K7145502	ABM	1.0 ug DNA	EUR 154

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 2)
K7145503	ABM	1.0 ug DNA	EUR 154

Moap1 sgRNA CRISPR Lentivector (Rat) (Target 3)
K7145504	ABM	1.0 ug DNA	EUR 154

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1314502	ABM	1.0 ug DNA	EUR 154

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 2)
K1314503	ABM	1.0 ug DNA	EUR 154

MOAP1 sgRNA CRISPR Lentivector (Human) (Target 3)
K1314504	ABM	1.0 ug DNA	EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3558002	ABM	1.0 ug DNA	EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3558003	ABM	1.0 ug DNA	EUR 154

Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3558004	ABM	1.0 ug DNA	EUR 154

MOAP1 Protein Vector (Mouse) (pPB-C-His)
PV201390	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Mouse) (pPB-N-His)
PV201391	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-HA)
PV201392	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-His)
PV201393	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Mouse) (pPB-C-His)
PV201394	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Mouse) (pPB-N-His)
PV201395	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-HA)
PV201396	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Mouse) (pPM-C-His)
PV201397	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Rat) (pPB-C-His)
PV282678	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Rat) (pPB-N-His)
PV282679	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Rat) (pPM-C-HA)
PV282680	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Rat) (pPM-C-His)
PV282681	ABM	500 ng	EUR 603

MOAP1 Protein Vector (Human) (pPB-C-His)
PV026225	ABM	500 ng	EUR 329

MOAP1 Protein Vector (Human) (pPB-N-His)
PV026226	ABM	500 ng	EUR 329

MOAP1 Protein Vector (Human) (pPM-C-HA)
PV026227	ABM	500 ng	EUR 329

MOAP1 Protein Vector (Human) (pPM-C-His)
PV026228	ABM	500 ng	EUR 329

Moap1 3'UTR Luciferase Stable Cell Line
TU113304	ABM	1.0 ml	Ask for price

Moap1 3'UTR GFP Stable Cell Line
TU163304	ABM	1.0 ml	Ask for price

Moap1 3'UTR Luciferase Stable Cell Line
TU213289	ABM	1.0 ml	Ask for price

Moap1 3'UTR GFP Stable Cell Line
TU263289	ABM	1.0 ml	Ask for price

MOAP1 3'UTR GFP Stable Cell Line
TU064417	ABM	1.0 ml	EUR 2333

MOAP1 3'UTR Luciferase Stable Cell Line
TU014417	ABM	1.0 ml	EUR 2333

Human Modulator of apoptosis 1, MOAP1 ELISA KIT
ELI-20830h	Lifescience Market	96 Tests	EUR 824

Mouse Modulator of apoptosis 1, Moap1 ELISA KIT
ELI-20831m	Lifescience Market	96 Tests	EUR 865

Human Modulator of apoptosis 1 (MOAP1) ELISA Kit
abx385167-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Modulator of apoptosis 1 (MOAP1) ELISA Kit
abx389916-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

MOAP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
LV627283	ABM	1.0 ug DNA	EUR 682

MOAP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
LV627287	ABM	1.0 ug DNA	EUR 682

MOAP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
LV627288	ABM	1.0 ug DNA	EUR 682

MOAP1 Modulator Of Apoptosis 1 Human Recombinant Protein
PROTQ96BY2	BosterBio	Regular: 20ug	EUR 317
Description: MOAP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 374 amino acids (1-351a.a) and having a molecular mass of 41.9kDa.MOAP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

GAPDH Rabbit Polyclonal Antibody
37985-100ul	SAB	100ul	EUR 252

GAPDH Rabbit Polyclonal Antibody
37985-50ul	SAB	50ul	EUR 187

EFHD1 Rabbit Polyclonal Antibody
38001-100ul	SAB	100ul	EUR 252

EFHD1 Rabbit Polyclonal Antibody
38001-50ul	SAB	50ul	EUR 187

Alliinase Rabbit Polyclonal Antibody
38042-100ul	SAB	100ul	EUR 252

Alliinase Rabbit Polyclonal Antibody
38042-50ul	SAB	50ul	EUR 187

ECFP Rabbit Polyclonal Antibody
38077-100ul	SAB	100ul	EUR 252

ECFP Rabbit Polyclonal Antibody
38077-50ul	SAB	50ul	EUR 187

EYFP Rabbit Polyclonal Antibody
38078-100ul	SAB	100ul	EUR 252

EYFP Rabbit Polyclonal Antibody
38078-50ul	SAB	50ul	EUR 187

mOrange Rabbit Polyclonal Antibody
38079-100ul	SAB	100ul	EUR 252

mOrange Rabbit Polyclonal Antibody
38079-50ul	SAB	50ul	EUR 187

MOAP1 Rabbit Polyclonal Antibody