MOAP1 Rabbit Polyclonal Antibody

MOAP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    MOAP1 Polyclonal Antibody
    ABP59300-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein
    MOAP1 Polyclonal Antibody
    ABP59300-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human MOAP1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of MOAP1 from Human. This MOAP1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human MOAP1 protein
    MOAP1 Polyclonal Antibody
    ES11803-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MOAP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
    MOAP1 Polyclonal Antibody
    ES11803-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MOAP1 from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA
    MOAP1 Rabbit pAb
    A12599-100ul 100 ul
    EUR 308
    MOAP1 Rabbit pAb
    A12599-200ul 200 ul
    EUR 459
    MOAP1 Rabbit pAb
    A12599-20ul 20 ul
    EUR 183
    MOAP1 Rabbit pAb
    A12599-50ul 50 ul
    EUR 223
    MOAP1 Rabbit pAb
    A5759-100ul 100 ul
    EUR 308
    MOAP1 Rabbit pAb
    A5759-200ul 200 ul
    EUR 459
    MOAP1 Rabbit pAb
    A5759-20ul 20 ul
    EUR 183
    MOAP1 Rabbit pAb
    A5759-50ul 50 ul
    EUR 223
    MOAP1 Polyclonal Conjugated Antibody
    C27726 100ul
    EUR 397
    MOAP1 Polyclonal Conjugated Antibody
    C30664 100ul
    EUR 397
    MOAP1 Antibody
    1-CSB-PA014693ESR2HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against MOAP1. Recognizes MOAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA
    Polyclonal MOAP1 / MAP1 Antibody (Internal)
    APR02274G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human MOAP1 / MAP1 (Internal). This antibody is tested and proven to work in the following applications:
    Anti-MOAP1 antibody
    STJ28326 100 µl
    EUR 277
    Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.
    Anti-MOAP1 antibody
    STJ114473 100 µl
    EUR 277
    Description: The protein encoded by this gene was identified by its interaction with apoptosis regulator BAX protein. This protein contains a Bcl-2 homology 3 (BH3)-like motif, which is required for the association with BAX. When overexpressed, this gene has been shown to mediate caspase-dependent apoptosis.
    Anti-MOAP1 antibody
    STJ192961 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to MOAP1
    MOAP1 siRNA
    20-abx924354
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    MOAP1 siRNA
    20-abx924355
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Modulator of apoptosis 1 (MOAP1) polyclonal antibody
    ABP-PAB-10271 100 ug Ask for price
      • Product line: Apoptosis
      • Brand:
    MOAP1 cloning plasmid
    CSB-CL014693HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1056
    • Sequence: atgactttgaggcttttagaagactggtgcagggggatggacatgaaccctcggaaagcgctattgattgccggcatctcccagagctgcagtgtggcagaaatcgaggaggctctgcaggctggtttagctcccttgggggagtacagactgcttggaaggatgttcaggaggg
    • Show more
    Description: A cloning plasmid for the MOAP1 gene.
    pCMV-SPORT6-MOAP1
    PVT13194 2 ug
    EUR 391
    MOAP1 protein (His tag)
    80R-3537 100 ug
    EUR 424
    Description: Purified recombinant MOAP1 protein (His tag)
    MOAP1 ELISA KIT|Human
    EF005290 96 Tests
    EUR 689
    Mouse MOAP1 shRNA Plasmid
    20-abx975258
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human MOAP1 shRNA Plasmid
    20-abx961927
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    MOAP1 Recombinant Protein (Human)
    RP019669 100 ug Ask for price
    MOAP1 Recombinant Protein (Mouse)
    RP151040 100 ug Ask for price
    MOAP1 Recombinant Protein (Mouse)
    RP151043 100 ug Ask for price
    MOAP1 Recombinant Protein (Rat)
    RP212006 100 ug Ask for price
    Modulator of Apoptosis 1 (MOAP1) Antibody
    20-abx006312
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Modulator of Apoptosis 1 (MOAP1) Antibody
    20-abx321726
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Monoclonal MOAP1 Antibody (monoclonal) (M01), Clone: 4A11
    AMM03806G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human MOAP1 (monoclonal) (M01). The antibodies are raised in mouse and are from clone 4A11. This antibody is applicable in WB, E
    Moap1 ORF Vector (Rat) (pORF)
    ORF070670 1.0 ug DNA
    EUR 506
    MOAP1 ORF Vector (Human) (pORF)
    ORF006557 1.0 ug DNA
    EUR 95
    Moap1 ORF Vector (Mouse) (pORF)
    ORF050348 1.0 ug DNA
    EUR 506
    Moap1 ORF Vector (Mouse) (pORF)
    ORF050349 1.0 ug DNA
    EUR 506
    Rabbit Anti-Mouse modulator of apoptosis 1 (MOAP1) IgG (aff pure)
    AB-23039-A 100ug
    EUR 482
    Human Modulator of apoptosis 1 (MOAP1)
    1-CSB-EP014693HU
    • EUR 380.00
    • EUR 214.00
    • EUR 1309.00
    • EUR 560.00
    • EUR 873.00
    • EUR 262.00
    • 100ug
    • 10ug
    • 1MG
    • 200ug
    • 500ug
    • 50ug
    • MW: 66.5 kDa
    • Buffer composition: Tris-based buffer with 50% glycerol.
    Description: Recombinant Human Modulator of apoptosis 1(MOAP1) expressed in E.coli
    Moap1 sgRNA CRISPR Lentivector set (Rat)
    K7145501 3 x 1.0 ug
    EUR 339
    MOAP1 sgRNA CRISPR Lentivector set (Human)
    K1314501 3 x 1.0 ug
    EUR 339
    Moap1 sgRNA CRISPR Lentivector set (Mouse)
    K3558001 3 x 1.0 ug
    EUR 339
    Moap1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7145502 1.0 ug DNA
    EUR 154
    Moap1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7145503 1.0 ug DNA
    EUR 154
    Moap1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7145504 1.0 ug DNA
    EUR 154
    MOAP1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1314502 1.0 ug DNA
    EUR 154
    MOAP1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1314503 1.0 ug DNA
    EUR 154
    MOAP1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1314504 1.0 ug DNA
    EUR 154
    Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3558002 1.0 ug DNA
    EUR 154
    Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3558003 1.0 ug DNA
    EUR 154
    Moap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3558004 1.0 ug DNA
    EUR 154
    MOAP1 Protein Vector (Mouse) (pPB-C-His)
    PV201390 500 ng
    EUR 603
    MOAP1 Protein Vector (Mouse) (pPB-N-His)
    PV201391 500 ng
    EUR 603
    MOAP1 Protein Vector (Mouse) (pPM-C-HA)
    PV201392 500 ng
    EUR 603
    MOAP1 Protein Vector (Mouse) (pPM-C-His)
    PV201393 500 ng
    EUR 603
    MOAP1 Protein Vector (Mouse) (pPB-C-His)
    PV201394 500 ng
    EUR 603
    MOAP1 Protein Vector (Mouse) (pPB-N-His)
    PV201395 500 ng
    EUR 603
    MOAP1 Protein Vector (Mouse) (pPM-C-HA)
    PV201396 500 ng
    EUR 603
    MOAP1 Protein Vector (Mouse) (pPM-C-His)
    PV201397 500 ng
    EUR 603
    MOAP1 Protein Vector (Rat) (pPB-C-His)
    PV282678 500 ng
    EUR 603
    MOAP1 Protein Vector (Rat) (pPB-N-His)
    PV282679 500 ng
    EUR 603
    MOAP1 Protein Vector (Rat) (pPM-C-HA)
    PV282680 500 ng
    EUR 603
    MOAP1 Protein Vector (Rat) (pPM-C-His)
    PV282681 500 ng
    EUR 603
    MOAP1 Protein Vector (Human) (pPB-C-His)
    PV026225 500 ng
    EUR 329
    MOAP1 Protein Vector (Human) (pPB-N-His)
    PV026226 500 ng
    EUR 329
    MOAP1 Protein Vector (Human) (pPM-C-HA)
    PV026227 500 ng
    EUR 329
    MOAP1 Protein Vector (Human) (pPM-C-His)
    PV026228 500 ng
    EUR 329
    Moap1 3'UTR Luciferase Stable Cell Line
    TU113304 1.0 ml Ask for price
    Moap1 3'UTR GFP Stable Cell Line
    TU163304 1.0 ml Ask for price
    Moap1 3'UTR Luciferase Stable Cell Line
    TU213289 1.0 ml Ask for price
    Moap1 3'UTR GFP Stable Cell Line
    TU263289 1.0 ml Ask for price
    MOAP1 3'UTR GFP Stable Cell Line
    TU064417 1.0 ml
    EUR 2333
    MOAP1 3'UTR Luciferase Stable Cell Line
    TU014417 1.0 ml
    EUR 2333
    Human Modulator of apoptosis 1, MOAP1 ELISA KIT
    ELI-20830h 96 Tests
    EUR 824
    Mouse Modulator of apoptosis 1, Moap1 ELISA KIT
    ELI-20831m 96 Tests
    EUR 865
    Human Modulator of apoptosis 1 (MOAP1) ELISA Kit
    abx385167-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    Mouse Modulator of apoptosis 1 (MOAP1) ELISA Kit
    abx389916-96tests 96 tests
    EUR 911
    • Shipped within 5-12 working days.
    MOAP1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)
    LV627283 1.0 ug DNA
    EUR 682
    MOAP1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)
    LV627287 1.0 ug DNA
    EUR 682
    MOAP1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)
    LV627288 1.0 ug DNA
    EUR 682
    MOAP1 Modulator Of Apoptosis 1 Human Recombinant Protein
    PROTQ96BY2 Regular: 20ug
    EUR 317
    Description: MOAP1 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 374 amino acids (1-351a.a) and having a molecular mass of 41.9kDa.MOAP1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187

    MOAP1 Rabbit Polyclonal Antibody