DLL4 Rabbit Polyclonal Antibody

DLL4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DLL4 Polyclonal Antibody

    ABP58385-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human DLL4 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of DLL4 from Human, Mouse. This DLL4 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human DLL4 protein

    DLL4 Rabbit pAb

    A12943-100ul 100 ul
    EUR 308

    DLL4 Rabbit pAb

    A12943-200ul 200 ul
    EUR 459

    DLL4 Rabbit pAb

    A12943-20ul 20 ul
    EUR 183

    DLL4 Rabbit pAb

    A12943-50ul 50 ul
    EUR 223

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    DLR-dLL4-Hu-48T 48T
    EUR 517
    • Should the Human Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 4 (dLL4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    DLR-dLL4-Hu-96T 96T
    EUR 673
    • Should the Human Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 4 (dLL4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    DLR-dLL4-Ra-48T 48T
    EUR 549
    • Should the Rat Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Delta Like Protein 4 (dLL4) in samples from tissue homogenates or other biological fluids.

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    DLR-dLL4-Ra-96T 96T
    EUR 718
    • Should the Rat Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Delta Like Protein 4 (dLL4) in samples from tissue homogenates or other biological fluids.

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    RDR-dLL4-Hu-48Tests 48 Tests
    EUR 544

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    RDR-dLL4-Hu-96Tests 96 Tests
    EUR 756

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    RDR-dLL4-Ra-48Tests 48 Tests
    EUR 583

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    RDR-dLL4-Ra-96Tests 96 Tests
    EUR 811

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    RD-dLL4-Hu-48Tests 48 Tests
    EUR 521

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    RD-dLL4-Hu-96Tests 96 Tests
    EUR 723

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    RD-dLL4-Ra-48Tests 48 Tests
    EUR 557

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    RD-dLL4-Ra-96Tests 96 Tests
    EUR 775

    Polyclonal DLL4 Antibody (C-term)

    APR11755G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DLL4 (C-term). This antibody is tested and proven to work in the following applications:

    Polyclonal DLL4 Antibody (internal region)

    APR11756G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DLL4 (internal region). This antibody is tested and proven to work in the following applications:

    DLL4 Antibody

    BF0366 200ul
    EUR 376
    Description: DLL4 antibody detects endogenous levels of total DLL4.

    DLL4 antibody

    70R-6608 50 ug
    EUR 467
    Description: Rabbit polyclonal DLL4 antibody

    DLL4 antibody

    70R-6414 50 ug
    EUR 467
    Description: Rabbit polyclonal DLL4 antibody

    DLL4 Antibody

    36418-100ul 100ul
    EUR 252

    DLL4 Antibody

    1-CSB-PA006949LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

    DLL4 Antibody

    1-CSB-PA831848
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

    DLL4 Antibody

    1-CSB-PA073786
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

    DLL4 Conjugated Antibody

    C36418 100ul
    EUR 397

    anti- DLL4 antibody

    FNab02416 100µg
    EUR 585
    • Immunogen: delta-like 4(Drosophila)
    • Uniprot ID: Q9NR61
    • Gene ID: 54567
    • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology, Stem Cells, Cell Division and Proliferation
    Description: Antibody raised against DLL4

    Anti-DLL4 Antibody

    A00875-1 100ug/vial
    EUR 294

    Anti-DLL4 antibody

    PAab02416 100 ug
    EUR 412

    Anti-DLL4 antibody

    STJ71295 100 µg
    EUR 359

    Anti-DLL4 antibody

    STJ114809 100 µl
    EUR 277
    Description: This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain.

    Anti-DLL4 antibody

    STJ193114 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DLL4

    DLL4 siRNA

    20-abx914242
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DLL4 siRNA

    20-abx914243
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DLL4 protein

    80R-4332 50 ug
    EUR 327
    Description: Purified Recombinant DLL4 protein (His tagged)

    anti-DLL4

    YF-PA26263 50 ul
    EUR 334
    Description: Mouse polyclonal to DLL4

    DLL4 Antibody, HRP conjugated

    1-CSB-PA006949LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    DLL4 Antibody, FITC conjugated

    1-CSB-PA006949LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    DLL4 Antibody, Biotin conjugated

    1-CSB-PA006949LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat)

    4-PAJ256Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4)

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat)

    4-PAJ256Ra02
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4)

    DLL4 Blocking Peptide

    BF0366-BP 1mg
    EUR 195

    DLL4 Blocking Peptide

    33R-7121 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DLL4 antibody, catalog no. 70R-6414

    DLL4 Blocking Peptide

    33R-7573 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DLL4 antibody, catalog no. 70R-6608

    Anti-DLL4 Purified

    11-717-C025 0.025 mg
    EUR 86

    Anti-DLL4 Purified

    11-717-C100 0.1 mg
    EUR 131

    DLL4 cloning plasmid

    CSB-CL878862HU-10ug 10ug
    EUR 686
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2058
    • Sequence: ATGGCGGCAGCGTCCCGGAGCGCCTCTGGCTGGGCGCTACTGCTGCTGGTGGCACTTTGGCAGCAGCGCGCGGCCGGCTCCGGCGTCTTCCAGCTGCAGCTGCAGGAGTTCATCAACGAGCGCGGCGTACTGGCCAGTGGGCGGCCTTGCGAGCCCGGCTGCCGGACTTTCTTCC
    • Show more
    Description: A cloning plasmid for the DLL4 gene.

    anti-DLL4 (4A11)

    LF-MA30736 100 ul
    EUR 527
    Description: Mouse Monoclonal to DLL4

    anti-DLL4 (4A11)

    LF-MA30749 100 ul
    EUR 527
    Description: Mouse Monoclonal to DLL4

    Anti-DLL4 (2E2)

    YF-MA11544 100 ug
    EUR 363
    Description: Mouse monoclonal to DLL4

    Monoclonal DLL4 Antibody, Clone: 4A11

    APR11754G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human DLL4. The antibodies are raised in Mouse and are from clone 4A11. This antibody is applicable in WB, FC, E

    Monoclonal DLL4 Antibody, Clone: 4A11F8

    AMM02902G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human DLL4. The antibodies are raised in Mouse and are from clone 4A11F8. This antibody is applicable in WB and IHC, E

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC

    4-PAJ256Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Biotinylated

    4-PAJ256Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Biotin.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Cy3

    4-PAJ256Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Cy3.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), FITC

    4-PAJ256Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with FITC.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), HRP

    4-PAJ256Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with HRP.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), PE

    4-PAJ256Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with PE.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC

    4-PAJ256Ra02-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Biotinylated

    4-PAJ256Ra02-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Biotin.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Cy3

    4-PAJ256Ra02-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Cy3.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), FITC

    4-PAJ256Ra02-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with FITC.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), HRP

    4-PAJ256Ra02-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with HRP.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), PE

    4-PAJ256Ra02-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with PE.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC-Cy7

    4-PAJ256Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC-Cy7.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC-Cy7

    4-PAJ256Ra02-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC-Cy7.

    Delta Like Protein 4 (DLL4) Antibody

    20-abx124017
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (dLL4) Antibody

    20-abx130019
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx140132-01mg 0.1 mg
    EUR 314
    • Shipped within 5-12 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx140133-01mg 0.1 mg
    EUR 314
    • Shipped within 5-12 working days.

    Delta Like Protein 4 (dLL4) Antibody

    20-abx102012
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx034592-400ul 400 ul
    EUR 551
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx034592-80l 80 µl
    EUR 321
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx037133-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx012164-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx015837-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (dLL4) Antibody

    20-abx172082
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Delta Like Protein 4 (dLL4) Antibody

    20-abx176138
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Delta-Like Protein 4 (DLL4) Antibody

    20-abx318069
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx432612-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Delta Like Protein 4 (DLL4) Antibody

    20-abx212394
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    20-abx212866
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx232416-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    Mouse DLL4 shRNA Plasmid

    20-abx974507
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    DLL4 ELISA KIT|Human

    EF007299 96 Tests
    EUR 689

    Human DLL4 shRNA Plasmid

    20-abx960138
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Recombinant Human DLL4 Protein

    RP00356 10 μg
    EUR 174

    DLL4 Recombinant Protein (Human)

    RP038542 100 ug Ask for price

    DLL4 Recombinant Protein (Rat)

    RP198176 100 ug Ask for price

    DLL4 Recombinant Protein (Mouse)

    RP129269 100 ug Ask for price

    Delta-Like Protein 4 (DLL4) Antibody (HRP)

    20-abx315231
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Delta-Like Protein 4 (DLL4) Antibody (FITC)

    20-abx315232
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Delta-Like Protein 4 (DLL4) Antibody (Biotin)

    20-abx315233
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody (RPE)

    abx415140-100tests 100 tests
    EUR 592
    • Shipped within 1 week.

    Delta Like Protein 4 (dLL4) Antibody (Biotin)

    20-abx273304
    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Anti-DLL4 -SMCC-DM1 ADC

    ADC-W-1022 1mg Ask for price
    Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a SMCC linker to DM1

    Anti-DLL4 -SPDB-DM4 ADC

    ADC-W-1023 1mg Ask for price
    Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a SPDB linker to DM4

    Anti-DLL4 -MC-MMAF ADC

    ADC-W-1024 1mg Ask for price
    Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a MC linker to MMAF

    Rat DLL4 PicoKine ELISA Kit

    EK1570 96 wells
    EUR 425
    Description: For quantitative detection of rat DLL4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

    ELISA kit for Mouse DLL4

    EK5567 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse DLL4 in samples from serum, plasma, tissue homogenates and other biological fluids.

    ELISA kit for Rat DLL4

    EK5747 96 tests
    EUR 553
    Description: Enzyme-linked immunosorbent assay kit for quantification of Rat DLL4 in samples from serum, plasma, tissue homogenates and other biological fluids.

    Mouse DLL4 PicoKine ELISA Kit

    EK1277 96 wells
    EUR 425
    Description: For quantitative detection of mouse DLL4 in cell culture supernates, cell lysates, serum and plasma (heparin, EDTA).

    Anti-DLL4 Purified Low Endotoxin

    12-717-C100 0.1 mg
    EUR 131

    Human CellExp? DLL4, Mouse Recombinant

    P1163-10
    EUR 207

    Human CellExp? DLL4, Mouse Recombinant

    P1163-50
    EUR 675

    Dll4 ORF Vector (Rat) (pORF)

    ORF066060 1.0 ug DNA
    EUR 506

    Dll4 ORF Vector (Mouse) (pORF)

    ORF043091 1.0 ug DNA
    EUR 506

    DLL4 ORF Vector (Human) (pORF)

    ORF012848 1.0 ug DNA
    EUR 354

    DLL4 ELISA Kit (Mouse) (OKBB00576)

    OKBB00576 96 Wells
    EUR 505
    Description: Description of target: Delta like ligand 4 is a protein that in humans is encoded by the DLL4 gene. It is mapped to 15q15.1. This gene is a homolog of the Drosophila delta gene. DLL4 is a transmembrane ligand for Notch receptors that shows restricted expression to endothelial cells (ECs), in particular to arteries and capillaries, and is involved in vascular development, and it also appeared to be a major trigger of Notch receptor activities previously implicated in arterial and vascular development. Mouse DLL4 could activate mouse Notch1 and mouse Notch4. DLL4 acts as a negative regulator of tumor angiogenesis, its blockade results in the striking uncoupling of tumor growth from vessel density, presenting a novel therapeutic approach even for tumors resistant to anti-VEGF therapies. In addition to it, this gene also plays an important role in promoting Th17 effector activity during mycobacterial challenge.;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: <= 10 pg/mL

    DLL4 ELISA Kit (Human) (OKCD09169)

    OKCD09169 96 Wells
    EUR 975
    Description: Description of target: Notch ligands family members are characterized by a DSL domain, EGF repeats, and a transmembrane domain. DLL4 plays a role in the Notch signaling pathway. IT activates Notch-1 and Notch-4. ;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

    DLL4 ELISA Kit (Rat) (OKCD09170)

    OKCD09170 96 Wells
    EUR 1053
    Description: Description of target: Involved in the notch signaling pathway as notch ligand. activates notch1 and notch4 (pubmed:25700513). involved in angiogenesis, negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. essential for retinal progenitor proliferation. required for suppressing rod fates in late retinal progenitors as well as for proper generation of other retinal cell types. during spinal cord neurogenesis, inhibits v2a interneuron fate (by similarity).;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: < 0.068ng/mL

    dLL4 ELISA Kit (Rat) (OKDD00764)

    OKDD00764 96 Wells
    EUR 1040
    Description: Description of target: Involved in the notch signaling pathway as notch ligand. activates notch1 and notch4 (pubmed:25700513). involved in angiogenesis, negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. essential for retinal progenitor proliferation. required for suppressing rod fates in late retinal progenitors as well as for proper generation of other retinal cell types. during spinal cord neurogenesis, inhibits v2a interneuron fate (by similarity).;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.068ng/mL

    DLL4 ELISA Kit (Rat) (OKBB01095)

    OKBB01095 96 Wells
    EUR 505
    Description: Description of target: Delta like ligand 4 is a protein that in humans is encoded by the DLL4 gene. It is mapped to 15q15.1. This gene is a homolog of the Drosophila delta gene. DLL4 is a transmembrane ligand for Notch receptors that shows restricted expression to endothelial cells (ECs), in particular to arteries and capillaries, and is involved in vascular development, and it also appeared to be a major trigger of Notch receptor activities previously implicated in arterial and vascular development. DLL4 acts as a negative regulator of tumor angiogenesis, its blockade results in the striking uncoupling of tumor growth from vessel density, presenting a novel therapeutic approach even for tumors resistant to anti-VEGF therapies. In addition to it, this gene also plays an important role in promoting Th17 effector activity during mycobacterial challenge. ;Species reactivity: Rat;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

    DLL4 ELISA Kit (Mouse) (OKEH06942)

    OKEH06942 96 Wells
    EUR 779
    Description: Description of target: Involved in the Notch signaling pathway as Notch ligand. Activates NOTCH1 and NOTCH4. Involved in angiogenesis; negatively regulates endothelial cell proliferation and migration and angiogenic sprouting. Essential for retinal progenitor proliferation. Required for suppressing rod fates in late retinal progenitors as well as for proper generation of other retinal cell types. During spinal cord neurogenesis, inhibits V2a interneuron fate.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.087 ng/mL

    Anti-DLL4 (Demcizumab)-SMCC-DM1 ADC

    ADC-W-1016 1mg Ask for price
    Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a SMCC linker to DM1

    Anti-DLL4 (Demcizumab)-SPDB-DM4 ADC

    ADC-W-1017 1mg Ask for price
    Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a SPDB linker to DM4

    Anti-DLL4 (Demcizumab)-MC-MMAF ADC

    ADC-W-1018 1mg Ask for price
    Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a MC linker to MMAF

    DLL4 sgRNA CRISPR Lentivector set (Human)

    K0607901 3 x 1.0 ug
    EUR 339

    Dll4 sgRNA CRISPR Lentivector set (Mouse)

    K4427301 3 x 1.0 ug
    EUR 339

    Dll4 sgRNA CRISPR Lentivector set (Rat)

    K7535901 3 x 1.0 ug
    EUR 339

    DLL4 Delta-Like 4Mouse Recombinant Protein

    PROTQ9JI71 Regular: 10ug
    EUR 317
    Description: DLL4 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (27-532 a.a.) and fused to a 6 aa His Tag at C-terminus containing a total of 512 amino acids and having a molecular mass of 55.8kDa.;DLL4 shows multiple bands between 50-70kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

    Recombinant Delta Like Protein 4 (dLL4)

    4-RPJ256Hu01
    • EUR 413.60
    • EUR 214.00
    • EUR 1276.00
    • EUR 492.00
    • EUR 884.00
    • EUR 340.00
    • EUR 3040.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q9NR61
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 23.4kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Delta Like Protein 4 expressed in: E.coli

    Recombinant Delta Like Protein 4 (dLL4)

    4-RPJ256Ra01
    • EUR 530.08
    • EUR 245.00
    • EUR 1712.80
    • EUR 637.60
    • EUR 1175.20
    • EUR 418.00
    • EUR 4132.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: D3ZHH1
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 14.3kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Rat Delta Like Protein 4 expressed in: E.coli

    Recombinant Delta Like Protein 4 (dLL4)

    4-RPJ256Ra02
    • EUR 530.08
    • EUR 245.00
    • EUR 1712.80
    • EUR 637.60
    • EUR 1175.20
    • EUR 418.00
    • EUR 4132.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: D3ZHH1
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 39.9kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Rat Delta Like Protein 4 expressed in: E.coli

    Human Delta Like Protein 4 (dLL4) Protein

    20-abx652251
    • EUR 578.00
    • EUR 258.00
    • EUR 1720.00
    • EUR 690.00
    • EUR 425.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Anti-DLL4 -MC-Vc-PAB-MMAE ADC

    ADC-W-1025 1mg Ask for price
    Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a MC-Vc linker to MMAE

    Anti-DLL4 -MC-Vc-PAB-SN38 ADC

    ADC-W-1026 1mg Ask for price
    Description: This ADC product is comprised of an anti-DLL4 monoclonal antibody conjugated via a MC-Vc-PAB linker to SN38

    DLL4 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0607902 1.0 ug DNA
    EUR 154

    DLL4 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0607903 1.0 ug DNA
    EUR 154

    DLL4 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0607904 1.0 ug DNA
    EUR 154

    Rat Delta Like Protein 4 (dLL4) Protein

    20-abx066300
    • EUR 732.00
    • EUR 286.00
    • EUR 2305.00
    • EUR 885.00
    • EUR 523.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Rat Delta Like Protein 4 (dLL4) Protein

    20-abx066301
    • EUR 732.00
    • EUR 286.00
    • EUR 2305.00
    • EUR 885.00
    • EUR 523.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Dll4 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4427302 1.0 ug DNA
    EUR 154

    Dll4 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4427303 1.0 ug DNA
    EUR 154

    Dll4 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4427304 1.0 ug DNA
    EUR 154

    Dll4 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7535902 1.0 ug DNA
    EUR 154

    Dll4 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7535903 1.0 ug DNA
    EUR 154

    Dll4 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7535904 1.0 ug DNA
    EUR 154

    DLL4 Protein Vector (Human) (pPB-C-His)

    PV051389 500 ng
    EUR 481

    DLL4 Protein Vector (Human) (pPB-N-His)

    PV051390 500 ng
    EUR 481

    DLL4 Protein Vector (Human) (pPM-C-HA)

    PV051391 500 ng
    EUR 481

    DLL4 Protein Vector (Human) (pPM-C-His)

    PV051392 500 ng
    EUR 481

    Recombinant Mouse DLL4 Protein, His, Insect-10ug

    QP11670-10ug 10ug
    EUR 201

    Recombinant Mouse DLL4 Protein, His, Insect-1mg

    QP11670-1mg 1mg
    EUR 5251

    Recombinant Mouse DLL4 Protein, His, Insect-2ug

    QP11670-2ug 2ug
    EUR 155

    DLL4 Protein Vector (Mouse) (pPB-C-His)

    PV172362 500 ng
    EUR 1065

    DLL4 Protein Vector (Mouse) (pPB-N-His)

    PV172363 500 ng
    EUR 1065

    DLL4 Protein Vector (Mouse) (pPM-C-HA)

    PV172364 500 ng
    EUR 1065

    DLL4 Protein Vector (Mouse) (pPM-C-His)

    PV172365 500 ng
    EUR 1065

    DLL4 Protein Vector (Rat) (pPB-C-His)

    PV264238 500 ng
    EUR 1166

    DLL4 Protein Vector (Rat) (pPB-N-His)

    PV264239 500 ng
    EUR 1166

    DLL4 Protein Vector (Rat) (pPM-C-HA)

    PV264240 500 ng
    EUR 1166

    DLL4 Protein Vector (Rat) (pPM-C-His)

    PV264241 500 ng
    EUR 1166

    Dll4 3'UTR Luciferase Stable Cell Line

    TU203456 1.0 ml Ask for price

    Dll4 3'UTR GFP Stable Cell Line

    TU155193 1.0 ml Ask for price

    DLL4 3'UTR Luciferase Stable Cell Line

    TU006071 1.0 ml
    EUR 1394

    Dll4 3'UTR Luciferase Stable Cell Line

    TU105193 1.0 ml Ask for price

    DLL4 3'UTR GFP Stable Cell Line

    TU056071 1.0 ml
    EUR 1394

    Dll4 3'UTR GFP Stable Cell Line

    TU253456 1.0 ml Ask for price

    DLL4 ELISA Kit (Human) : 96 Wells (OKEH02321)

    OKEH02321 96 Wells
    EUR 818
    Description: Description of target: This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    WIPI2 Rabbit Polyclonal Antibody

    ES8580-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against WIPI2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Gab1 Rabbit Polyclonal Antibody

    ES8582-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Gab1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ERK1 Rabbit Polyclonal Antibody

    ES8583-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ERK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    NM23A Rabbit Polyclonal Antibody

    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    ATM Rabbit Polyclonal Antibody

    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    DLL4 Rabbit Polyclonal Antibody