DLL4 Rabbit Polyclonal Antibody

DLL4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    DLL4 Polyclonal Antibody

    ES11956-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against DLL4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    DLL4 Rabbit pAb

    A12943-100ul 100 ul
    EUR 308

    DLL4 Rabbit pAb

    A12943-200ul 200 ul
    EUR 459

    DLL4 Rabbit pAb

    A12943-20ul 20 ul
    EUR 183

    DLL4 Rabbit pAb

    A12943-50ul 50 ul
    EUR 223

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    DLR-dLL4-Hu-48T 48T
    EUR 517
    • Should the Human Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 4 (dLL4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    DLR-dLL4-Hu-96T 96T
    EUR 673
    • Should the Human Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Delta Like Protein 4 (dLL4) in samples from tissue homogenates, cell lysates or other biological fluids.

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    DLR-dLL4-Ra-48T 48T
    EUR 549
    • Should the Rat Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Delta Like Protein 4 (dLL4) in samples from tissue homogenates or other biological fluids.

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    DLR-dLL4-Ra-96T 96T
    EUR 718
    • Should the Rat Delta Like Protein 4 (dLL4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Rat Delta Like Protein 4 (dLL4) in samples from tissue homogenates or other biological fluids.

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    RDR-dLL4-Hu-48Tests 48 Tests
    EUR 544

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    RDR-dLL4-Hu-96Tests 96 Tests
    EUR 756

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    RDR-dLL4-Ra-48Tests 48 Tests
    EUR 583

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    RDR-dLL4-Ra-96Tests 96 Tests
    EUR 811

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    RD-dLL4-Hu-48Tests 48 Tests
    EUR 521

    Human Delta Like Protein 4 (dLL4) ELISA Kit

    RD-dLL4-Hu-96Tests 96 Tests
    EUR 723

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    RD-dLL4-Ra-48Tests 48 Tests
    EUR 557

    Rat Delta Like Protein 4 (dLL4) ELISA Kit

    RD-dLL4-Ra-96Tests 96 Tests
    EUR 775

    Polyclonal DLL4 Antibody (C-term)

    APR11755G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human DLL4 (C-term). This antibody is tested and proven to work in the following applications:

    Polyclonal DLL4 Antibody (internal region)

    APR11756G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human DLL4 (internal region). This antibody is tested and proven to work in the following applications:

    DLL4 Antibody

    36418-100ul 100ul
    EUR 252

    DLL4 Antibody

    1-CSB-PA831848
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:10000, IHC:1:100-1:300

    DLL4 Antibody

    1-CSB-PA073786
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

    DLL4 Antibody

    1-CSB-PA006949LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

    DLL4 antibody

    70R-6608 50 ug
    EUR 467
    Description: Rabbit polyclonal DLL4 antibody

    DLL4 antibody

    70R-6414 50 ug
    EUR 467
    Description: Rabbit polyclonal DLL4 antibody

    DLL4 Antibody

    BF0366 200ul
    EUR 376
    Description: DLL4 antibody detects endogenous levels of total DLL4.

    Anti-DLL4 Antibody

    A00875-1 100ug/vial
    EUR 294

    DLL4 Conjugated Antibody

    C36418 100ul
    EUR 397

    anti- DLL4 antibody

    FNab02416 100µg
    EUR 585
    • Immunogen: delta-like 4(Drosophila)
    • Uniprot ID: Q9NR61
    • Gene ID: 54567
    • Research Area: Signal Transduction, Metabolism, Cardiovascular, Immunology, Developmental biology, Stem Cells, Cell Division and Proliferation
    Description: Antibody raised against DLL4

    Anti-DLL4 antibody

    PAab02416 100 ug
    EUR 412

    Anti-DLL4 antibody

    STJ114809 100 µl
    EUR 277
    Description: This gene is a homolog of the Drosophila delta gene. The delta gene family encodes Notch ligands that are characterized by a DSL domain, EGF repeats, and a transmembrane domain.

    Anti-DLL4 antibody

    STJ193114 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to DLL4

    Anti-DLL4 antibody

    STJ71295 100 µg
    EUR 359

    DLL4 protein

    80R-4332 50 ug
    EUR 327
    Description: Purified Recombinant DLL4 protein (His tagged)

    DLL4 siRNA

    20-abx914242
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    DLL4 siRNA

    20-abx914243
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-DLL4

    YF-PA26263 50 ul
    EUR 334
    Description: Mouse polyclonal to DLL4

    DLL4 Antibody, HRP conjugated

    1-CSB-PA006949LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    DLL4 Antibody, FITC conjugated

    1-CSB-PA006949LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    DLL4 Antibody, Biotin conjugated

    1-CSB-PA006949LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against DLL4. Recognizes DLL4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat)

    4-PAJ256Ra01
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4)

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat)

    4-PAJ256Ra02
    • EUR 259.00
    • EUR 2708.00
    • EUR 670.00
    • EUR 328.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4)

    DLL4 Blocking Peptide

    33R-7121 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DLL4 antibody, catalog no. 70R-6414

    DLL4 Blocking Peptide

    33R-7573 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of DLL4 antibody, catalog no. 70R-6608

    Anti-DLL4 Purified

    11-717-C025 0.025 mg
    EUR 86

    Anti-DLL4 Purified

    11-717-C100 0.1 mg
    EUR 131

    DLL4 Blocking Peptide

    BF0366-BP 1mg
    EUR 195

    DLL4 cloning plasmid

    CSB-CL878862HU-10ug 10ug
    EUR 686
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2058
    • Sequence: ATGGCGGCAGCGTCCCGGAGCGCCTCTGGCTGGGCGCTACTGCTGCTGGTGGCACTTTGGCAGCAGCGCGCGGCCGGCTCCGGCGTCTTCCAGCTGCAGCTGCAGGAGTTCATCAACGAGCGCGGCGTACTGGCCAGTGGGCGGCCTTGCGAGCCCGGCTGCCGGACTTTCTTCC
    • Show more
    Description: A cloning plasmid for the DLL4 gene.

    anti-DLL4 (4A11)

    LF-MA30736 100 ul
    EUR 527
    Description: Mouse Monoclonal to DLL4

    anti-DLL4 (4A11)

    LF-MA30749 100 ul
    EUR 527
    Description: Mouse Monoclonal to DLL4

    Anti-DLL4 (2E2)

    YF-MA11544 100 ug
    EUR 363
    Description: Mouse monoclonal to DLL4

    Monoclonal DLL4 Antibody, Clone: 4A11

    APR11754G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human DLL4. The antibodies are raised in Mouse and are from clone 4A11. This antibody is applicable in WB, FC, E

    Monoclonal DLL4 Antibody, Clone: 4A11F8

    AMM02902G 0.1ml
    EUR 528
    Description: A Monoclonal antibody against Human DLL4. The antibodies are raised in Mouse and are from clone 4A11F8. This antibody is applicable in WB and IHC, E

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC

    4-PAJ256Ra01-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Biotinylated

    4-PAJ256Ra01-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Biotin.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Cy3

    4-PAJ256Ra01-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Cy3.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), FITC

    4-PAJ256Ra01-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with FITC.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), HRP

    4-PAJ256Ra01-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with HRP.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), PE

    4-PAJ256Ra01-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with PE.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC

    4-PAJ256Ra02-APC
    • EUR 364.00
    • EUR 3545.00
    • EUR 980.00
    • EUR 467.00
    • EUR 227.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Biotinylated

    4-PAJ256Ra02-Biotin
    • EUR 325.00
    • EUR 2658.00
    • EUR 777.00
    • EUR 400.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Biotin.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), Cy3

    4-PAJ256Ra02-Cy3
    • EUR 444.00
    • EUR 4685.00
    • EUR 1265.00
    • EUR 581.00
    • EUR 261.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with Cy3.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), FITC

    4-PAJ256Ra02-FITC
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with FITC.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), HRP

    4-PAJ256Ra02-HRP
    • EUR 332.00
    • EUR 3089.00
    • EUR 866.00
    • EUR 421.00
    • EUR 213.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with HRP.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), PE

    4-PAJ256Ra02-PE
    • EUR 311.00
    • EUR 2856.00
    • EUR 804.00
    • EUR 393.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with PE.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC-Cy7

    4-PAJ256Ra01-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly214~Ser330)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC-Cy7.

    Delta Like Protein 4 (dLL4) Polyclonal Antibody (Rat), APC-Cy7

    4-PAJ256Ra02-APC-Cy7
    • EUR 608.00
    • EUR 6970.00
    • EUR 1840.00
    • EUR 814.00
    • EUR 335.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: dLL4 (Gly215~Ser331)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Delta Like Protein 4 (dLL4). This antibody is labeled with APC-Cy7.

    Delta Like Protein 4 (DLL4) Antibody

    abx015837-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (dLL4) Antibody

    20-abx176138
    • EUR 1205.00
    • EUR 578.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Delta Like Protein 4 (DLL4) Antibody

    20-abx212394
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    20-abx212866
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (dLL4) Antibody

    20-abx102012
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-12 working days.

    Delta Like Protein 4 (DLL4) Antibody

    20-abx124017
    • EUR 411.00
    • EUR 592.00
    • 100 ul
    • 200 ul
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx037133-100ug 100 ug
    EUR 391
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (dLL4) Antibody

    20-abx130019
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx140132-01mg 0.1 mg
    EUR 314
    • Shipped within 5-12 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx140133-01mg 0.1 mg
    EUR 314
    • Shipped within 5-12 working days.

    Delta Like Protein 4 (dLL4) Antibody

    20-abx172082
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Delta Like Protein 4 (DLL4) Antibody

    abx012164-100ug 100 ug
    EUR 411
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx034592-400ul 400 ul
    EUR 551
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx034592-80l 80 µl
    EUR 321
    • Shipped within 5-10 working days.

    Delta-Like Protein 4 (DLL4) Antibody

    20-abx318069
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx432612-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Delta Like Protein 4 (DLL4) Antibody

    abx232416-100ug 100 ug
    EUR 551
    • Shipped within 5-12 working days.

    DLL4 ELISA KIT|Human

    EF007299 96 Tests
    EUR 689

    Mouse DLL4 shRNA Plasmid

    20-abx974507
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human DLL4 shRNA Plasmid

    20-abx960138
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Recombinant Human DLL4 Protein

    RP00356 10 μg
    EUR 174

    DLL4 Recombinant Protein (Human)

    RP038542 100 ug Ask for price

    DLL4 Recombinant Protein (Rat)

    RP198176 100 ug Ask for price

    DLL4 Recombinant Protein (Mouse)

    RP129269 100 ug Ask for price

    Delta Like Protein 4 (dLL4) Antibody (Biotin)

    20-abx273304
    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Delta-Like Protein 4 (DLL4) Antibody (HRP)

    20-abx315231
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Delta-Like Protein 4 (DLL4) Antibody (FITC)

    20-abx315232
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Delta-Like Protein 4 (DLL4) Antibody (Biotin)

    20-abx315233
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    DLL4 Rabbit Polyclonal Antibody