LPAR4 Rabbit Polyclonal Antibody

LPAR4 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    LPAR4 Polyclonal Antibody
    ES11623-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against LPAR4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    LPAR4 Polyclonal Antibody
    ES11623-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against LPAR4 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    LPAR4 Rabbit pAb
    A3060-100ul 100 ul
    EUR 308
    LPAR4 Rabbit pAb
    A3060-200ul 200 ul
    EUR 459
    LPAR4 Rabbit pAb
    A3060-20ul 20 ul Ask for price
    LPAR4 Rabbit pAb
    A3060-50ul 50 ul
    EUR 223
    LPAR4 Antibody
    31253-100ul 100ul
    EUR 252
    LPAR4 Antibody
    31253-50ul 50ul
    EUR 187
    LPAR4 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:200-1:1000, IHC:1:25-1:100
    LPAR4 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:5000, WB:1:200-1:1000
    LPAR4 Antibody
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100
    LPAR4 Antibody
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:1000-1:5000, IHC:1:200-1:500, IF:1:50-1:200
    LPAR4 Polyclonal Antibody, HRP Conjugated
    A62887 100 µg
    EUR 570.55
    Description: Ask the seller for details
    LPAR4 Polyclonal Antibody, FITC Conjugated
    A62888 100 µg
    EUR 570.55
    Description: The best epigenetics products
    LPAR4 Polyclonal Antibody, Biotin Conjugated
    A62889 100 µg
    EUR 570.55
    Description: kits suitable for this type of research
    Polyclonal LPAR4 / GPR23 Antibody (Cytoplasmic Domain)
    APR12452G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (Cytoplasmic Domain). This antibody is tested and proven to work in the following applications:
    Polyclonal LPAR4 / GPR23 Antibody (N-Terminus)
    APR12453G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (N-Terminus). This antibody is tested and proven to work in the following applications:
    Polyclonal LPAR4 antibody - C-terminal region
    APR12454G 0.05mg
    EUR 528
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 - C-terminal region. This antibody is tested and proven to work in the following applications:
    Polyclonal LPAR4 / GPR23 Antibody (C-Terminus)
    AMM06330G 0.05mg
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human LPAR4 / GPR23 (C-Terminus). This antibody is tested and proven to work in the following applications:
    LPAR4 Conjugated Antibody
    C31253 100ul
    EUR 397
    anti- LPAR4 antibody
    FNab04824 100µg
    EUR 505.25
    • Immunogen: lysophosphatidic acid receptor 4
    • Uniprot ID: Q99677
    • Gene ID: 2846
    • Research Area: Signal Transduction
    Description: Antibody raised against LPAR4
    Anti-LPAR4 antibody
    PAab04824 100 ug
    EUR 355
    Anti-LPAR4 antibody
    STJ24418 100 µl
    EUR 277
    Description: This gene encodes a member of the lysophosphatidic acid receptor family. It may also be related to the P2Y receptors, a family of receptors that bind purine and pyrimidine nucleotides and are coupled to G proteins. The encoded protein may play a role in monocytic differentiation.
    Anti-LPAR4 antibody
    STJ192781 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to LPAR4
    LPAR4 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LPAR4 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    LPAR4 Antibody, HRP conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    LPAR4 Antibody, FITC conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    LPAR4 Antibody, Biotin conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against LPAR4. Recognizes LPAR4 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    LPAR4 cloning plasmid
    CSB-CL013050HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1113
    • Sequence: atgggtgacagaagattcattgacttccaattccaagattcaaattcaagcctcagacccaggttgggcaatgctactgccaataatacttgcattgttgatgattccttcaagtataatctcaatggtgctgtctacagtgttgcattcatcttgggtctgataaccaacagtg
    • Show more
    Description: A cloning plasmid for the LPAR4 gene.
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
    • EUR 411.00
    • EUR 592.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
    abx234824-100ug 100 ug
    EUR 481
    • Shipped within 5-12 working days.
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Human LPAR4 ELISA Kit
    ELA-E0645h 96 Tests
    EUR 824
    EF000680 96 Tests
    EUR 689
    Mouse LPAR4 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human LPAR4 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    LPAR4 Recombinant Protein (Human)
    RP018139 100 ug Ask for price
    LPAR4 Recombinant Protein (Mouse)
    RP147935 100 ug Ask for price
    LPAR4 Recombinant Protein (Rat)
    RP209795 100 ug Ask for price
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (HRP)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (FITC)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Lysophosphatidic Acid Receptor 4 (LPAR4) Antibody (Biotin)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Lpar4 ORF Vector (Rat) (pORF)
    ORF069933 1.0 ug DNA
    EUR 506
    LPAR4 ORF Vector (Human) (pORF)
    ORF006047 1.0 ug DNA
    EUR 95
    Lpar4 ORF Vector (Mouse) (pORF)
    ORF049313 1.0 ug DNA
    EUR 506
    LPAR4 ELISA Kit (Mouse) (OKEH03171)
    OKEH03171 96 Wells
    EUR 662
    Description: Description of target: Receptor for lysophosphatidic acid (LPA), a mediator of diverse cellular activities. Transduces a signal by increasing the intracellular calcium ions and by stimulating adenylyl cyclase activity. The rank order of potency for agonists of this receptor is 1-oleoyl- > 1-stearoyl- > 1-palmitoyl- > 1-myristoyl- > 1-alkyl- > 1-alkenyl-LPA.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.082 ng/mL
    Lpar4 sgRNA CRISPR Lentivector set (Rat)
    K6376401 3 x 1.0 ug
    EUR 339
    Lpar4 sgRNA CRISPR Lentivector set (Mouse)
    K3832101 3 x 1.0 ug
    EUR 339
    LPAR4 sgRNA CRISPR Lentivector set (Human)
    K1225901 3 x 1.0 ug
    EUR 339
    Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6376402 1.0 ug DNA
    EUR 154
    Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6376403 1.0 ug DNA
    EUR 154
    Lpar4 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6376404 1.0 ug DNA
    EUR 154
    Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3832102 1.0 ug DNA
    EUR 154
    Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3832103 1.0 ug DNA
    EUR 154
    Lpar4 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3832104 1.0 ug DNA
    EUR 154
    LPAR4 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1225902 1.0 ug DNA
    EUR 154
    LPAR4 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1225903 1.0 ug DNA
    EUR 154
    LPAR4 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1225904 1.0 ug DNA
    EUR 154
    LPAR4 3'UTR Luciferase Stable Cell Line
    TU012572 1.0 ml
    EUR 1394
    Lpar4 3'UTR Luciferase Stable Cell Line
    TU112532 1.0 ml Ask for price
    Lpar4 3'UTR GFP Stable Cell Line
    TU162532 1.0 ml Ask for price
    Lpar4 3'UTR Luciferase Stable Cell Line
    TU212488 1.0 ml Ask for price
    Lpar4 3'UTR GFP Stable Cell Line
    TU262488 1.0 ml Ask for price
    LPAR4 3'UTR GFP Stable Cell Line
    TU062572 1.0 ml
    EUR 1394
    LPAR4 Protein Vector (Human) (pPB-C-His)
    PV024185 500 ng
    EUR 329
    LPAR4 Protein Vector (Human) (pPB-N-His)
    PV024186 500 ng
    EUR 329
    LPAR4 Protein Vector (Human) (pPM-C-HA)
    PV024187 500 ng
    EUR 329
    LPAR4 Protein Vector (Human) (pPM-C-His)
    PV024188 500 ng
    EUR 329

    LPAR4 Rabbit Polyclonal Antibody