BIRC2 Rabbit Polyclonal Antibody

BIRC2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    BIRC2 Polyclonal Antibody

    ES11955-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against BIRC2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

    BIRC2 Rabbit pAb

    A0866-100ul 100 ul
    EUR 308

    BIRC2 Rabbit pAb

    A0866-200ul 200 ul
    EUR 459

    BIRC2 Rabbit pAb

    A0866-20ul 20 ul
    EUR 183

    BIRC2 Rabbit pAb

    A0866-50ul 50 ul
    EUR 223

    BIRC2 Rabbit pAb

    A0985-100ul 100 ul
    EUR 308

    BIRC2 Rabbit pAb

    A0985-200ul 200 ul
    EUR 459

    BIRC2 Rabbit pAb

    A0985-20ul 20 ul
    EUR 183

    BIRC2 Rabbit pAb

    A0985-50ul 50 ul
    EUR 223

    BIRC2 Rabbit mAb

    A19688-100ul 100 ul
    EUR 410

    BIRC2 Rabbit mAb

    A19688-200ul 200 ul
    EUR 571

    BIRC2 Rabbit mAb

    A19688-20ul 20 ul
    EUR 221

    BIRC2 Rabbit mAb

    A19688-50ul 50 ul
    EUR 287

    BIRC2 antibody

    70R-15999 50 ul
    EUR 435
    Description: Rabbit polyclonal BIRC2 antibody

    BIRC2 Antibody

    32110-100ul 100ul
    EUR 252

    BIRC2 antibody

    10R-10665 100 ug
    EUR 381
    Description: Mouse monoclonal BIRC2 antibody

    BIRC2 Antibody

    1-CSB-PA830383
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:1000-1:5000, WB:1:500-1:2000, IHC:1:25-1:100

    BIRC2 Antibody

    1-CSB-PA002703GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

    BIRC2 Antibody

    1-CSB-PA618777EA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:5000

    BIRC2 Antibody

    1-CSB-PA618777ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC; Recommended dilution: WB:1:200-1:1000, IHC:1:20-1:200

    BIRC2 Antibody

    DF6167 200ul
    EUR 304
    Description: BIRC2 Antibody detects endogenous levels of total BIRC2.

    BIRC2 Antibody

    1-CSB-PA191509
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

    BIRC2 Antibody

    ABD6167 100 ug
    EUR 438

    BIRC2 Conjugated Antibody

    C32110 100ul
    EUR 397

    Anti-BIRC2 antibody

    STJ114903 100 µl
    EUR 277
    Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

    Anti-BIRC2 antibody

    STJ193113 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to BIRC2

    Anti-BIRC2 antibody

    STJ22800 100 µl
    EUR 277
    Description: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

    BIRC2 siRNA

    20-abx909114
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    BIRC2 siRNA

    20-abx909115
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    BIRC2 Antibody, HRP conjugated

    1-CSB-PA618777EB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    BIRC2 Antibody, FITC conjugated

    1-CSB-PA618777EC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    BIRC2 Antibody, Biotin conjugated

    1-CSB-PA618777ED01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against BIRC2. Recognizes BIRC2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    Anti-cIAP1/BIRC2 Antibody

    A01700-1 100ug/vial
    EUR 334

    BIRC2 recombinant monoclonal antibody

    A5797 100ul X 3
    EUR 595
    • Comparisons between Mnoclonal, Polyclonal and Recombinant antibodies and their benefits: Regular monoclonal antibodies have higher purity, better specificity and less lot-to-lot variations than polyclonal antibodies. Recombinant antibodies, however,
    • Show more
    Description: A recombinant monoclonal antibody from rabbit against human BIRC2 for WB,ELISA

    Anti-BIRC2 Monoclonal Antibody

    M01700 100ug
    EUR 397
    Description: Rabbit Monoclonal BIRC2 Antibody. Validated in IF, WB and tested in Human.

    BIRC2 Blocking Peptide

    DF6167-BP 1mg
    EUR 195

    BIRC2 cloning plasmid

    CSB-CL618777HU-10ug 10ug
    EUR 376
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1857
    • Sequence: atgcacaaaactgcctcccaaagacttttcccaggtccctcgtatcaaaacattaagagtataatggaagatagcacgatcttgtcagattggacaaacagcaacaaacaaaaaatgaagtatgacttttcctgtgaactctacagaatgtctacatattcaactttccccgccg
    • Show more
    Description: A cloning plasmid for the BIRC2 gene.

    pCMV-SPORT6-BIRC2

    PVT13208 2 ug
    EUR 391

    pBluescriptR-BIRC2 Plasmid

    PVT17205 2 ug
    EUR 325

    Human BIRC2 ELISA Kit

    ELA-E10854h 96 Tests
    EUR 824

    Mouse Birc2 ELISA KIT

    ELI-25177m 96 Tests
    EUR 865

    BIRC2 ELISA KIT|Human

    EF008515 96 Tests
    EUR 689

    Mouse BIRC2 shRNA Plasmid

    20-abx969182
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human BIRC2 shRNA Plasmid

    20-abx950230
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human BIRC2 ELISA KIT

    ELI-33316h 96 Tests
    EUR 824

    BIRC2 Recombinant Protein (Human)

    RP003058 100 ug Ask for price

    BIRC2 Recombinant Protein (Rat)

    RP192203 100 ug Ask for price

    BIRC2 Recombinant Protein (Mouse)

    RP119591 100 ug Ask for price

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human)

    4-PAE231Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Asn148~Ser298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2)

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human)

    4-PAE231Hu02
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Phe344~Gln593)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2)

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), APC

    4-PAE231Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Asn148~Ser298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with APC.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), Biotinylated

    4-PAE231Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Asn148~Ser298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with Biotin.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), Cy3

    4-PAE231Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Asn148~Ser298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with Cy3.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), FITC

    4-PAE231Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Asn148~Ser298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with FITC.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), HRP

    4-PAE231Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Asn148~Ser298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with HRP.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), PE

    4-PAE231Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Asn148~Ser298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with PE.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), APC

    4-PAE231Hu02-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Phe344~Gln593)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with APC.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), Biotinylated

    4-PAE231Hu02-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Phe344~Gln593)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with Biotin.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), Cy3

    4-PAE231Hu02-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Phe344~Gln593)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with Cy3.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), FITC

    4-PAE231Hu02-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Phe344~Gln593)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with FITC.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), HRP

    4-PAE231Hu02-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Phe344~Gln593)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with HRP.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), PE

    4-PAE231Hu02-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Phe344~Gln593)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with PE.

    Birc2 ORF Vector (Rat) (pORF)

    ORF064069 1.0 ug DNA
    EUR 506

    BIRC2 ORF Vector (Human) (pORF)

    ORF001020 1.0 ug DNA
    EUR 95

    Birc2 ORF Vector (Mouse) (pORF)

    ORF039865 1.0 ug DNA
    EUR 506

    BIRC2 ELISA Kit (Mouse) (OKEH05703)

    OKEH05703 96 Wells
    EUR 870
    Description: Description of target: Multi-functional protein which regulates not only caspases and apoptosis, but also modulates inflammatory signaling and immunity, mitogenic kinase signaling, and cell proliferation, as well as cell invasion and metastasis. Acts as an E3 ubiquitin-protein ligase regulating NF-kappa-B signaling and regulates both canonical and non-canonical NF-kappa-B signaling by acting in opposite directions: acts as a positive regulator of the canonical pathway and suppresses constitutive activation of non-canonical NF-kappa-B signaling. The target proteins for its E3 ubiquitin-protein ligase activity include: RIPK1, RIPK2, RIPK3, RIPK4, CASP3, CASP7, CASP8, TRAF2, DIABLO/SMAC, MAP3K14/NIK, MAP3K5/ASK1, IKBKG/NEMO, IKBKE and MXD1/MAD1. Can also function as an E3 ubiquitin-protein ligase of the NEDD8 conjugation pathway, targeting effector caspases for neddylation and inactivation. Acts as an important regulator of innate immune signaling via regulation of Toll-like receptors (TLRs), Nodlike receptors (NLRs) and RIG-I like receptors (RLRs), collectively referred to as pattern recognition receptors (PRRs). Protects cells from spontaneous formation of the ripoptosome, a large multi-protein complex that has the capability to kill cancer cells in a caspase-dependent and caspase-independent manner. Suppresses ripoptosome formation by ubiquitinating RIPK1 and CASP8. Can stimulate the transcriptional activity of E2F1. Plays a role in the modulation of the cell cycle.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.086 ng/mL

    BIRC2 ELISA Kit (Human) (OKEH02117)

    OKEH02117 96 Wells
    EUR 740
    Description: Description of target: The protein encoded by this gene is a member of a family of proteins that inhibits apoptosis by binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2, probably by interfering with activation of ICE-like proteases. This encoded protein inhibits apoptosis induced by serum deprivation and menadione, a potent inducer of free radicals. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 34 pg/mL

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), APC-Cy7

    4-PAE231Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Asn148~Ser298)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with APC-Cy7.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Polyclonal Antibody (Human), APC-Cy7

    4-PAE231Hu02-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: BIRC2 (Phe344~Gln593)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Baculoviral IAP Repeat Containing Protein 2 (BIRC2). This antibody is labeled with APC-Cy7.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody

    20-abx211979
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody

    20-abx212336
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody

    20-abx104325
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody

    20-abx111179
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody

    20-abx128632
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Baculoviral IAP Repeat-Containing Protein 2 (BIRC2) Antibody

    20-abx318738
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Baculoviral IAP Repeat-Containing Protein 2 (BIRC2) Antibody

    20-abx321438
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Baculoviral IAP Repeat-Containing Protein 2 (BIRC2) Antibody

    20-abx000938
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Birc2 sgRNA CRISPR Lentivector set (Rat)

    K6825101 3 x 1.0 ug
    EUR 339

    BIRC2 sgRNA CRISPR Lentivector set (Human)

    K0184201 3 x 1.0 ug
    EUR 339

    Birc2 sgRNA CRISPR Lentivector set (Mouse)

    K4705101 3 x 1.0 ug
    EUR 339

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody (FITC)

    20-abx271053
    • EUR 481.00
    • EUR 244.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Baculoviral IAP Repeat Containing Protein 2 (BIRC2) Antibody (Biotin)

    20-abx271316
    • EUR 453.00
    • EUR 244.00
    • EUR 1316.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-15 working days.

    Baculoviral IAP Repeat-Containing Protein 2 (BIRC2) Antibody (HRP)

    20-abx317353
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Baculoviral IAP Repeat-Containing Protein 2 (BIRC2) Antibody (FITC)

    20-abx317354
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Baculoviral IAP Repeat-Containing Protein 2 (BIRC2) Antibody (Biotin)

    20-abx317355
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    Birc2 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6825102 1.0 ug DNA
    EUR 154

    Birc2 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6825103 1.0 ug DNA
    EUR 154

    Birc2 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6825104 1.0 ug DNA
    EUR 154

    BIRC2 sgRNA CRISPR Lentivector (Human) (Target 1)

    K0184202 1.0 ug DNA
    EUR 154

    BIRC2 sgRNA CRISPR Lentivector (Human) (Target 2)

    K0184203 1.0 ug DNA
    EUR 154

    BIRC2 sgRNA CRISPR Lentivector (Human) (Target 3)

    K0184204 1.0 ug DNA
    EUR 154

    Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4705102 1.0 ug DNA
    EUR 154

    Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4705103 1.0 ug DNA
    EUR 154

    Birc2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4705104 1.0 ug DNA
    EUR 154

    BIRC2 Protein Vector (Mouse) (pPB-C-His)

    PV159458 500 ng
    EUR 603

    BIRC2 Protein Vector (Mouse) (pPB-N-His)

    PV159459 500 ng
    EUR 603

    BIRC2 Rabbit Polyclonal Antibody