TIAM1 Rabbit Polyclonal Antibody

TIAM1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    TIAM1 Polyclonal Antibody
    ABP60682-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human TIAM1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of TIAM1 from Human, Mouse. This TIAM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIAM1 protein
    TIAM1 Polyclonal Antibody
    ABP60682-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human TIAM1 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of TIAM1 from Human, Mouse. This TIAM1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human TIAM1 protein
    TIAM1 Polyclonal Antibody
    ES11819-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against TIAM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    TIAM1 Polyclonal Antibody
    ES11819-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against TIAM1 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    TIAM1 Rabbit pAb
    A10252-100ul 100 ul
    EUR 308
    TIAM1 Rabbit pAb
    A10252-200ul 200 ul
    EUR 459
    TIAM1 Rabbit pAb
    A10252-20ul 20 ul
    EUR 183
    TIAM1 Rabbit pAb
    A10252-50ul 50 ul
    EUR 223
    TIAM1 Polyclonal Conjugated Antibody
    C27344 100ul
    EUR 397
    TIAM1 Antibody
    1-CSB-PA614387LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200
    Anti-TIAM1 Antibody
    PB10103 100ug/vial
    EUR 294
    Anti-TIAM1 antibody
    STJ112290 100 µl
    EUR 277
    Anti-TIAM1 antibody
    STJ73468 100 µg
    EUR 359
    Anti-TIAM1 antibody
    STJ192977 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to TIAM1
    TIAM1 siRNA
    20-abx936755
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    TIAM1 Antibody, HRP conjugated
    1-CSB-PA614387LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    TIAM1 Antibody, FITC conjugated
    1-CSB-PA614387LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    TIAM1 Antibody, Biotin conjugated
    1-CSB-PA614387LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against TIAM1. Recognizes TIAM1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    TIAM1 cloning plasmid
    CSB-CL614387HU-10ug 10ug
    EUR 1858
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 4776
    • Sequence: atgggaaacgcagaaagtcaacatgtagagcacgagttttatggagaaaagcatgccagcctggggcgcaagcacacttcccgctccctgcgcctctcgcacaagacgcggaggaccaggcacgcttcctcggggaaggtgatccacaggaactccgaagtgagcacccgatcca
    • Show more
    Description: A cloning plasmid for the TIAM1 gene.
    Mouse Tiam1 ELISA KIT
    ELI-16271m 96 Tests
    EUR 865
    Human TIAM1 ELISA KIT
    ELI-52047h 96 Tests
    EUR 824
    Human TIAM1 shRNA Plasmid
    20-abx954843
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Tiam1 ORF Vector (Rat) (pORF)
    ORF077704 1.0 ug DNA
    EUR 2080
    TIAM1 ORF Vector (Human) (pORF)
    ORF014713 1.0 ug DNA
    EUR 354
    Tiam1 ORF Vector (Mouse) (pORF)
    ORF059565 1.0 ug DNA
    EUR 1572
    Tiam1 ORF Vector (Mouse) (pORF)
    ORF059566 1.0 ug DNA
    EUR 506
    Tiam1 ORF Vector (Mouse) (pORF)
    ORF059567 1.0 ug DNA
    EUR 1572
    Tiam1 sgRNA CRISPR Lentivector set (Rat)
    K6559201 3 x 1.0 ug
    EUR 339
    Tiam1 sgRNA CRISPR Lentivector set (Mouse)
    K3772601 3 x 1.0 ug
    EUR 339
    TIAM1 sgRNA CRISPR Lentivector set (Human)
    K2372801 3 x 1.0 ug
    EUR 339
    Active Rac-GEF Assay Kit (Tiam1)
    STA-422 20 assays
    EUR 867
    Description: Guanine nucleotide exchange factors (GEFs) activate the small GTPases by catalyzing the exchange of GDP for GTP. Our Active Rac-GEF Assay Kit employs the visible agarose bead technology used in our Small GTPase Activation Assays to pull down the active form of Rac-GEF from endogenous lysates or purified samples. The specific GEF known as Tiam1 is then specifically detected with a polyclonal antibody.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human)
    4-PAC778Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1)
    Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6559202 1.0 ug DNA
    EUR 154
    Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6559203 1.0 ug DNA
    EUR 154
    Tiam1 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6559204 1.0 ug DNA
    EUR 154
    Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K3772602 1.0 ug DNA
    EUR 154
    Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K3772603 1.0 ug DNA
    EUR 154
    Tiam1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K3772604 1.0 ug DNA
    EUR 154
    TIAM1 sgRNA CRISPR Lentivector (Human) (Target 1)
    K2372802 1.0 ug DNA
    EUR 154
    TIAM1 sgRNA CRISPR Lentivector (Human) (Target 2)
    K2372803 1.0 ug DNA
    EUR 154
    TIAM1 sgRNA CRISPR Lentivector (Human) (Target 3)
    K2372804 1.0 ug DNA
    EUR 154
    TIAM1 Protein Vector (Rat) (pPB-C-His)
    PV310814 500 ng
    EUR 2675
    TIAM1 Protein Vector (Rat) (pPB-N-His)
    PV310815 500 ng
    EUR 2675
    TIAM1 Protein Vector (Rat) (pPM-C-HA)
    PV310816 500 ng
    EUR 2675
    TIAM1 Protein Vector (Rat) (pPM-C-His)
    PV310817 500 ng
    EUR 2675
    TIAM1 Protein Vector (Human) (pPB-C-His)
    PV058849 500 ng
    EUR 481
    TIAM1 Protein Vector (Human) (pPB-N-His)
    PV058850 500 ng
    EUR 481
    TIAM1 Protein Vector (Human) (pPM-C-HA)
    PV058851 500 ng
    EUR 481
    TIAM1 Protein Vector (Human) (pPM-C-His)
    PV058852 500 ng
    EUR 481
    TIAM1 Protein Vector (Mouse) (pPB-C-His)
    PV238258 500 ng
    EUR 2676
    TIAM1 Protein Vector (Mouse) (pPB-N-His)
    PV238259 500 ng
    EUR 2676
    TIAM1 Protein Vector (Mouse) (pPM-C-HA)
    PV238260 500 ng
    EUR 2676
    TIAM1 Protein Vector (Mouse) (pPM-C-His)
    PV238261 500 ng
    EUR 2676
    TIAM1 Protein Vector (Mouse) (pPB-C-His)
    PV238262 500 ng
    EUR 603
    TIAM1 Protein Vector (Mouse) (pPB-N-His)
    PV238263 500 ng
    EUR 603
    TIAM1 Protein Vector (Mouse) (pPM-C-HA)
    PV238264 500 ng
    EUR 603
    TIAM1 Protein Vector (Mouse) (pPM-C-His)
    PV238265 500 ng
    EUR 603
    TIAM1 Protein Vector (Mouse) (pPB-C-His)
    PV238266 500 ng
    EUR 2676
    TIAM1 Protein Vector (Mouse) (pPB-N-His)
    PV238267 500 ng
    EUR 2676
    TIAM1 Protein Vector (Mouse) (pPM-C-HA)
    PV238268 500 ng
    EUR 2676
    TIAM1 Protein Vector (Mouse) (pPM-C-His)
    PV238269 500 ng
    EUR 2676
    Tiam1 3'UTR Luciferase Stable Cell Line
    TU120482 1.0 ml Ask for price
    Tiam1 3'UTR GFP Stable Cell Line
    TU170482 1.0 ml Ask for price
    Tiam1 3'UTR Luciferase Stable Cell Line
    TU221882 1.0 ml Ask for price
    TIAM1 3'UTR GFP Stable Cell Line
    TU075569 1.0 ml
    EUR 2333
    Tiam1 3'UTR GFP Stable Cell Line
    TU271882 1.0 ml Ask for price
    TIAM1 3'UTR Luciferase Stable Cell Line
    TU025569 1.0 ml
    EUR 2333
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), APC
    4-PAC778Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with APC.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), Biotinylated
    4-PAC778Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with Biotin.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), Cy3
    4-PAC778Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with Cy3.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), FITC
    4-PAC778Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with FITC.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), HRP
    4-PAC778Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with HRP.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), PE
    4-PAC778Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with PE.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Polyclonal Antibody (Human), APC-Cy7
    4-PAC778Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TIAM1 (Asp1261~Lys1397)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1). This antibody is labeled with APC-Cy7.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody
    20-abx126703
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody
    20-abx130499
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody
    abx031302-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody
    abx031302-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody
    abx433488-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.
    T-Cell Lymphoma Invasion And Metastasis Inducing Protein 1 (TIAM1) Antibody
    20-abx313325
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    GAPDH Rabbit Polyclonal Antibody
    37985-100ul 100ul
    EUR 252
    GAPDH Rabbit Polyclonal Antibody
    37985-50ul 50ul
    EUR 187
    EFHD1 Rabbit Polyclonal Antibody
    38001-100ul 100ul
    EUR 252
    EFHD1 Rabbit Polyclonal Antibody
    38001-50ul 50ul
    EUR 187
    Alliinase Rabbit Polyclonal Antibody
    38042-100ul 100ul
    EUR 252
    Alliinase Rabbit Polyclonal Antibody
    38042-50ul 50ul
    EUR 187
    ECFP Rabbit Polyclonal Antibody
    38077-100ul 100ul
    EUR 252
    ECFP Rabbit Polyclonal Antibody
    38077-50ul 50ul
    EUR 187
    EYFP Rabbit Polyclonal Antibody
    38078-100ul 100ul
    EUR 252
    EYFP Rabbit Polyclonal Antibody
    38078-50ul 50ul
    EUR 187
    mOrange Rabbit Polyclonal Antibody
    38079-100ul 100ul
    EUR 252
    mOrange Rabbit Polyclonal Antibody
    38079-50ul 50ul
    EUR 187
    mStrawberry Rabbit Polyclonal Antibody
    38083-100ul 100ul
    EUR 252
    mStrawberry Rabbit Polyclonal Antibody
    38083-50ul 50ul
    EUR 187
    AmCyan Rabbit Polyclonal Antibody
    38086-100ul 100ul
    EUR 252
    AmCyan Rabbit Polyclonal Antibody
    38086-50ul 50ul
    EUR 187
    EBFP Rabbit Polyclonal Antibody
    38087-100ul 100ul
    EUR 252

    TIAM1 Rabbit Polyclonal Antibody