RBMS1 Rabbit Polyclonal Antibody

RBMS1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    RBMS1 Rabbit pAb

    A3079-100ul 100 ul
    EUR 308

    RBMS1 Rabbit pAb

    A3079-200ul 200 ul
    EUR 459

    RBMS1 Rabbit pAb

    A3079-20ul 20 ul
    EUR 183

    RBMS1 Rabbit pAb

    A3079-50ul 50 ul
    EUR 223

    RBMS1 antibody

    70R-1624 100 ug
    EUR 377
    Description: Rabbit polyclonal RBMS1 antibody raised against the C terminal of RBMS1

    RBMS1 antibody

    70R-1625 100 ug
    EUR 377
    Description: Rabbit polyclonal RBMS1 antibody raised against the middle region of RBMS1

    RBMS1 antibody

    70R-19819 50 ul
    EUR 435
    Description: Rabbit polyclonal RBMS1 antibody

    RBMS1 Antibody

    37024-100ul 100ul
    EUR 252

    RBMS1 Antibody

    1-CSB-PA145037
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

    RBMS1 Antibody

    1-CSB-PA265034
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:1000-1:5000, IHC:1:25-1:100

    RBMS1 Antibody

    1-CSB-PA019440GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20oC, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IF

    RBMS1 Antibody

    1-CSB-PA019440LA01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IF; Recommended dilution: WB:1:500-1:5000, IF:1:50-1:200

    RBMS1 Conjugated Antibody

    C37024 100ul
    EUR 397

    anti- RBMS1 antibody

    FNab07185 100µg
    EUR 548.75
    • Immunogen: RNA binding motif, single stranded interacting protein 1
    • Uniprot ID: P29558
    • Gene ID: 5937
    • Research Area: Metabolism
    Description: Antibody raised against RBMS1

    Anti-RBMS1 antibody

    PAab07185 100 ug
    EUR 386

    Anti-RBMS1 antibody

    STJ27687 100 µl
    EUR 277
    Description: This gene encodes a member of a small family of proteins which bind single stranded DNA/RNA. These proteins are characterized by the presence of two sets of ribonucleoprotein consensus sequence (RNP-CS) that contain conserved motifs, RNP1 and RNP2, originally described in RNA binding proteins, and required for DNA binding. These proteins have been implicated in such diverse functions as DNA replication, gene transcription, cell cycle progression and apoptosis. Several transcript variants, resulting from alternative splicing and encoding different isoforms, have been described. A pseudogene for this locus is found on chromosome 12.

    Anti-RBMS1 antibody

    STJ193093 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to RBMS1

    Rbms1/ Rat Rbms1 ELISA Kit

    ELI-52317r 96 Tests
    EUR 886

    RBMS1 siRNA

    20-abx904507
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBMS1 siRNA

    20-abx931096
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    RBMS1 siRNA

    20-abx931097
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    anti-RBMS1

    YF-PA14320 50 ul
    EUR 363
    Description: Mouse polyclonal to RBMS1

    anti-RBMS1

    YF-PA14321 50 ug
    EUR 363
    Description: Mouse polyclonal to RBMS1

    anti-RBMS1

    YF-PA14322 100 ul
    EUR 403
    Description: Rabbit polyclonal to RBMS1

    anti-RBMS1

    YF-PA14323 100 ug
    EUR 403
    Description: Rabbit polyclonal to RBMS1

    anti-RBMS1

    YF-PA14324 50 ul
    EUR 363
    Description: Mouse polyclonal to RBMS1

    anti-RBMS1

    YF-PA14325 100 ug
    EUR 403
    Description: Rabbit polyclonal to RBMS1

    anti-RBMS1

    YF-PA14326 100 ug
    EUR 403
    Description: Rabbit polyclonal to RBMS1

    anti-RBMS1

    YF-PA24559 50 ul
    EUR 334
    Description: Mouse polyclonal to RBMS1

    RBMS1 Antibody, HRP conjugated

    1-CSB-PA019440LB01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

    RBMS1 Antibody, FITC conjugated

    1-CSB-PA019440LC01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

    RBMS1 Antibody, Biotin conjugated

    1-CSB-PA019440LD01HU
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against RBMS1. Recognizes RBMS1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

    RBMS1 Blocking Peptide

    33R-3655 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS1 antibody, catalog no. 70R-1625

    RBMS1 Blocking Peptide

    33R-9396 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of RBMS1 antibody, catalog no. 70R-1624

    RBMS1 cloning plasmid

    CSB-CL019440HU1-10ug 10ug
    EUR 451
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1221
    • Sequence: atgggcaaagtgtggaaacagcagatgtaccctcagtacgccacctactattacccccagtatctgcaagccaagcagtctctggtcccagcccaccccatggcccctcccagtcccagcaccaccagcagtaataacaacagtagcagcagtagcaactcaggatgggatcagc
    • Show more
    Description: A cloning plasmid for the RBMS1 gene.

    RBMS1 cloning plasmid

    CSB-CL019440HU2-10ug 10ug
    EUR 448
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1212
    • Sequence: atgggcaaagtgtggaaacagcagatgtaccctcagtacgccacctactattacccccagtatctgcaagccaagcagtctctggtcccagcccaccccatggcccctcccagtcccagcaccaccagcagtaataacaacagtagcagcagtagcaactcaggatgggatcagc
    • Show more
    Description: A cloning plasmid for the RBMS1 gene.

    pCMV-SPORT6-RBMS1

    PVT14167 2 ug
    EUR 495

    Anti-RBMS1 (M1)

    YF-MA15128 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Anti-RBMS1 (3B12)

    YF-MA15129 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Anti-RBMS1 (3B2)

    YF-MA15130 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Anti-RBMS1 (4E2)

    YF-MA15131 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Bovine RBMS1 ELISA KIT

    ELI-14150b 96 Tests
    EUR 928

    Human RBMS1 ELISA KIT

    ELI-19259h 96 Tests
    EUR 824

    Mouse Rbms1 ELISA KIT

    ELI-22543m 96 Tests
    EUR 865

    RBMS1 ELISA KIT|Human

    EF002371 96 Tests
    EUR 689

    Rat RBMS1 shRNA Plasmid

    20-abx990329
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse RBMS1 shRNA Plasmid

    20-abx974934
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human RBMS1 shRNA Plasmid

    20-abx954023
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    RBMS1 Recombinant Protein (Human)

    RP025999 100 ug Ask for price

    RBMS1 Recombinant Protein (Human)

    RP026002 100 ug Ask for price

    RBMS1 Recombinant Protein (Human)

    RP042790 100 ug Ask for price

    RBMS1 Recombinant Protein (Mouse)

    RP167246 100 ug Ask for price

    RBMS1 Recombinant Protein (Mouse)

    RP167249 100 ug Ask for price

    RBMS1 Recombinant Protein (Mouse)

    RP167252 100 ug Ask for price

    RBMS1 Recombinant Protein (Rat)

    RP223877 100 ug Ask for price

    Anti-RBMS1 (3F2-2G9)

    YF-MA15127 100 ug
    EUR 363
    Description: Mouse monoclonal to RBMS1

    Rbms1 ORF Vector (Rat) (pORF)

    ORF074627 1.0 ug DNA
    EUR 506

    RBMS1 ORF Vector (Human) (pORF)

    ORF014264 1.0 ug DNA
    EUR 354

    RBMS1 ORF Vector (Human) (pORF)

    ORF008667 1.0 ug DNA
    EUR 95

    RBMS1 ORF Vector (Human) (pORF)

    ORF008668 1.0 ug DNA
    EUR 95

    Rbms1 ORF Vector (Mouse) (pORF)

    ORF055750 1.0 ug DNA
    EUR 506

    Rbms1 ORF Vector (Mouse) (pORF)

    ORF055751 1.0 ug DNA
    EUR 506

    Rbms1 ORF Vector (Mouse) (pORF)

    ORF055752 1.0 ug DNA
    EUR 506

    Rbms1 sgRNA CRISPR Lentivector set (Rat)

    K6622901 3 x 1.0 ug
    EUR 339

    RBMS1 sgRNA CRISPR Lentivector set (Human)

    K1796301 3 x 1.0 ug
    EUR 339

    Rbms1 sgRNA CRISPR Lentivector set (Mouse)

    K4750901 3 x 1.0 ug
    EUR 339

    Rbms1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K6622902 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K6622903 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K6622904 1.0 ug DNA
    EUR 154

    RBMS1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K1796302 1.0 ug DNA
    EUR 154

    RBMS1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K1796303 1.0 ug DNA
    EUR 154

    RBMS1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K1796304 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4750902 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4750903 1.0 ug DNA
    EUR 154

    Rbms1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4750904 1.0 ug DNA
    EUR 154

    RBMS1 Protein Vector (Rat) (pPB-C-His)

    PV298506 500 ng
    EUR 603

    RBMS1 Protein Vector (Rat) (pPB-N-His)

    PV298507 500 ng
    EUR 603

    RBMS1 Protein Vector (Rat) (pPM-C-HA)

    PV298508 500 ng
    EUR 603

    RBMS1 Protein Vector (Rat) (pPM-C-His)

    PV298509 500 ng
    EUR 603

    RBMS1 Protein Vector (Human) (pPB-C-His)

    PV034665 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPB-N-His)

    PV034666 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPM-C-HA)

    PV034667 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPM-C-His)

    PV034668 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPB-C-His)

    PV034669 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPB-N-His)

    PV034670 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPM-C-HA)

    PV034671 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPM-C-His)

    PV034672 500 ng
    EUR 329

    RBMS1 Protein Vector (Human) (pPB-C-His)

    PV057053 500 ng
    EUR 481

    RBMS1 Protein Vector (Human) (pPB-N-His)

    PV057054 500 ng
    EUR 481

    RBMS1 Protein Vector (Human) (pPM-C-HA)

    PV057055 500 ng
    EUR 481

    RBMS1 Protein Vector (Human) (pPM-C-His)

    PV057056 500 ng
    EUR 481

    RBMS1 Protein Vector (Mouse) (pPB-C-His)

    PV222998 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-N-His)

    PV222999 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-HA)

    PV223000 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-His)

    PV223001 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-C-His)

    PV223002 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-N-His)

    PV223003 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-HA)

    PV223004 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-His)

    PV223005 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-C-His)

    PV223006 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPB-N-His)

    PV223007 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-HA)

    PV223008 500 ng
    EUR 603

    RBMS1 Protein Vector (Mouse) (pPM-C-His)

    PV223009 500 ng
    EUR 603

    Rbms1 3'UTR Luciferase Stable Cell Line

    TU117639 1.0 ml Ask for price

    Rbms1 3'UTR GFP Stable Cell Line

    TU167639 1.0 ml Ask for price

    Rbms1 3'UTR Luciferase Stable Cell Line

    TU217402 1.0 ml Ask for price

    Rbms1 3'UTR GFP Stable Cell Line

    TU267402 1.0 ml Ask for price

    RBMS1 3'UTR GFP Stable Cell Line

    TU069619 1.0 ml
    EUR 4617

    RBMS1 3'UTR Luciferase Stable Cell Line

    TU019619 1.0 ml
    EUR 4617

    Suppressor of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx007302
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Suppressor Of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx214386
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Suppressor Of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx214508
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Suppressor of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx115327
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Suppressor of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    abx237185-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Suppressor Of CDC2 With RNA-Binding Motif 2 (RBMS1) Antibody

    20-abx338604
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    NM23A Rabbit Polyclonal Antibody

    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    ATM Rabbit Polyclonal Antibody

    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    RBMS1 Rabbit Polyclonal Antibody