CD8B Rabbit Polyclonal Antibody

CD8B Rabbit Polyclonal Antibody

Contact Us Below To Order :

    CD8B Polyclonal Antibody

    ES11787-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD8B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    CD8B Polyclonal Antibody

    ES11787-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD8B from Human. This antibody is tested and validated for WB, ELISA, WB, ELISA

    CD8B Rabbit pAb

    A3286-100ul 100 ul
    EUR 308

    CD8B Rabbit pAb

    A3286-200ul 200 ul
    EUR 459

    CD8B Rabbit pAb

    A3286-20ul 20 ul
    EUR 183

    CD8B Rabbit pAb

    A3286-50ul 50 ul
    EUR 223

    CD8B Polyclonal Conjugated Antibody

    C30440 100ul
    EUR 397

    CD8B antibody

    70R-16290 50 ul
    EUR 435
    Description: Rabbit polyclonal CD8B antibody

    CD8b antibody

    10R-CD8baCKp 500 ug
    EUR 403
    Description: Mouse monoclonal CD8b antibody

    CD8b antibody

    10R-6339 50 ug
    EUR 133
    Description: Mouse monoclonal CD8b antibody

    CD8B Antibody

    1-CSB-PA004967ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against CD8B. Recognizes CD8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    CD8B Antibody

    1-CSB-PA004967GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
    Description: A polyclonal antibody against CD8B. Recognizes CD8B from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB

    CD8B antibody

    70R-8544 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal CD8B antibody

    CD8b antibody

    70R-51260 100 ul
    EUR 244
    Description: Purified Polyclonal CD8b antibody

    CD8B antibody

    70R-5987 50 ug
    EUR 467
    Description: Rabbit polyclonal CD8B antibody raised against the middle region of CD8B

    CD8B antibody

    70R-5988 50 ug
    EUR 467
    Description: Rabbit polyclonal CD8B antibody raised against the N terminal of CD8B

    CD8B Antibody

    AF5138 200ul
    EUR 304
    Description: CD8B Antibody detects endogenous levels of total CD8B.

    CD8B Antibody

    ABF5138 100 ug
    EUR 438

    CD8B

    PR27298 5 ug
    EUR 191

    CD8b antibody (FITC)

    61R-1045 50 ug
    EUR 181
    Description: Mouse monoclonal CD8b antibody (FITC)

    CD8b antibody (PE)

    61R-1204 100 ug
    EUR 354
    Description: Mouse monoclonal CD8b antibody (PE)

    CD8b antibody (biotin)

    61R-CD8baCKBT 500 ug
    EUR 457
    Description: Mouse monoclonal CD8b antibody (biotin)

    CD8b antibody (FITC)

    61R-CD8baCKFT 500 ug
    EUR 565
    Description: Mouse monoclonal CD8b antibody (FITC)

    CD8b antibody (PE)

    61R-CD8baCKPE 100 ug
    EUR 349
    Description: Mouse monoclonal CD8b antibody (PE)

    anti- CD8B antibody

    FNab01506 100µg
    EUR 505.25
    • Immunogen: CD8b molecule
    • Uniprot ID: P10966
    • Gene ID: 926
    • Research Area: Immunology
    Description: Antibody raised against CD8B

    Anti-CD8B antibody

    PAab01506 100 ug
    EUR 355

    Anti-CD8b antibody

    STJ16101131 100 µg
    EUR 354

    Anti-CD8B antibody

    STJ192945 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to CD8B

    Anti-CD8B antibody

    STJ23016 100 µl
    EUR 277
    Description: The CD8 antigen is a cell surface glycoprotein found on most cytotoxic T lymphocytes that mediates efficient cell-cell interactions within the immune system. The CD8 antigen, acting as a coreceptor, and the T-cell receptor on the T lymphocyte recognize antigens displayed by an antigen presenting cell (APC) in the context of class I MHC molecules. The functional coreceptor is either a homodimer composed of two alpha chains, or a heterodimer composed of one alpha and one beta chain. Both alpha and beta chains share significant homology to immunoglobulin variable light chains. This gene encodes the CD8 beta chain isoforms. Multiple alternatively spliced transcript variants encoding distinct membrane associated or secreted isoforms have been described. A pseudogene, also located on chromosome 2, has been identified.

    Cd8b/ Rat Cd8b ELISA Kit

    ELI-10708r 96 Tests
    EUR 886

    CD8B siRNA

    20-abx900925
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CD8B siRNA

    20-abx911091
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    CD8B siRNA

    20-abx911092
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse)

    4-PAQ127Mu01
    • EUR 266.00
    • EUR 2813.00
    • EUR 694.00
    • EUR 337.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Thr175)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b)

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat)

    4-PAQ127Ra01
    • EUR 275.00
    • EUR 2958.00
    • EUR 727.00
    • EUR 350.00
    • EUR 226.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Ala21~Lys208)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b)

    CD8B Blocking Peptide

    33R-4582 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-5987

    CD8B Blocking Peptide

    33R-4815 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-8544

    CD8B Blocking Peptide

    33R-7989 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CD8B antibody, catalog no. 70R-5988

    CD8B, human recombinant

    7320-100
    EUR 370

    CD8b Blocking Peptide

    20-abx064135
    • EUR 272.00
    • EUR 411.00
    • 1 mg
    • 5 mg
    • Shipped within 5-10 working days.

    CD8B Blocking Peptide

    AF5138-BP 1mg
    EUR 195

    CD8B cloning plasmid

    CSB-CL004967HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 732
    • Sequence: ATGCGGCCGCGGCTGTGGCTCCTCCTGGCCGCGCAGCTGACAGTTCTCCATGGCAACTCAGTCCTCCAGCAGACCCCTGCATACATAAAGGTGCAAACCAACAAGATGGTGATGCTGTCCTGCGAGGCTAAAATCTCCCTCAGTAACATGCGCATCTACTGGCTGAGACAGCGCCA
    • Show more
    Description: A cloning plasmid for the CD8B gene.

    CD8A- CD8B Plasmid

    PVT7144 2 ug
    EUR 266

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), APC

    4-PAQ127Mu01-APC
    • EUR 374.00
    • EUR 3689.00
    • EUR 1016.00
    • EUR 481.00
    • EUR 232.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Thr175)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), Biotinylated

    4-PAQ127Mu01-Biotin
    • EUR 332.00
    • EUR 2763.00
    • EUR 803.00
    • EUR 411.00
    • EUR 228.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Thr175)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), Cy3

    4-PAQ127Mu01-Cy3
    • EUR 457.00
    • EUR 4877.00
    • EUR 1313.00
    • EUR 600.00
    • EUR 267.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Thr175)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), FITC

    4-PAQ127Mu01-FITC
    • EUR 319.00
    • EUR 2971.00
    • EUR 832.00
    • EUR 405.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Thr175)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), HRP

    4-PAQ127Mu01-HRP
    • EUR 341.00
    • EUR 3213.00
    • EUR 897.00
    • EUR 433.00
    • EUR 217.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Thr175)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), PE

    4-PAQ127Mu01-PE
    • EUR 319.00
    • EUR 2971.00
    • EUR 832.00
    • EUR 405.00
    • EUR 205.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Thr175)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), APC

    4-PAQ127Ra01-APC
    • EUR 388.00
    • EUR 3887.00
    • EUR 1065.00
    • EUR 501.00
    • EUR 237.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Ala21~Lys208)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), Biotinylated

    4-PAQ127Ra01-Biotin
    • EUR 343.00
    • EUR 2908.00
    • EUR 839.00
    • EUR 425.00
    • EUR 232.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Ala21~Lys208)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), Cy3

    4-PAQ127Ra01-Cy3
    • EUR 476.00
    • EUR 5141.00
    • EUR 1379.00
    • EUR 626.00
    • EUR 275.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Ala21~Lys208)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), FITC

    4-PAQ127Ra01-FITC
    • EUR 330.00
    • EUR 3129.00
    • EUR 872.00
    • EUR 420.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Ala21~Lys208)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), HRP

    4-PAQ127Ra01-HRP
    • EUR 353.00
    • EUR 3385.00
    • EUR 940.00
    • EUR 451.00
    • EUR 222.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Ala21~Lys208)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), PE

    4-PAQ127Ra01-PE
    • EUR 330.00
    • EUR 3129.00
    • EUR 872.00
    • EUR 420.00
    • EUR 210.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Ala21~Lys208)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat)

    4-PAQ127Hu01
    • EUR 261.00
    • EUR 2734.00
    • EUR 676.00
    • EUR 330.00
    • EUR 220.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Pro170)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b)

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Mouse), APC-Cy7

    4-PAQ127Mu01-APC-Cy7
    • EUR 628.00
    • EUR 7258.00
    • EUR 1912.00
    • EUR 842.00
    • EUR 344.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Thr175)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Mouse Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Rat), APC-Cy7

    4-PAQ127Ra01-APC-Cy7
    • EUR 657.00
    • EUR 7654.00
    • EUR 2011.00
    • EUR 882.00
    • EUR 355.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Ala21~Lys208)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

    Cluster of Differentiation 8b (CD8b) Antibody

    20-abx102989
    • EUR 453.00
    • EUR 133.00
    • EUR 1302.00
    • EUR 620.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Cluster of Differentiation 8b (CD8b) Antibody

    20-abx102990
    • EUR 467.00
    • EUR 133.00
    • EUR 1344.00
    • EUR 634.00
    • EUR 342.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Cluster of Differentiation 8b (CD8b) Antibody

    20-abx102991
    • EUR 481.00
    • EUR 133.00
    • EUR 1414.00
    • EUR 662.00
    • EUR 356.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Cluster of Differentiation 8b (CD8B) Antibody

    20-abx111498
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Cluster Of Differentiation 8b (CD8b) Antibody

    20-abx171799
    • EUR 926.00
    • EUR 467.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Cluster of Differentiation 8b (CD8b) Antibody

    20-abx270089
    • EUR 523.00
    • EUR 606.00
    • EUR 300.00
    • EUR 940.00
    • EUR 384.00
    • 100 tests
    • 200 tests
    • 25 tests
    • 500 tests
    • 50 tests
    • Shipped within 5-12 working days.

    Anti-Rt CD8b Purified

    11-656-C100 0.1 mg
    EUR 131

    Anti-Ms CD8b Purified

    11-779-C025 0.025 mg
    EUR 99

    Anti-Ms CD8b Purified

    11-779-C100 0.1 mg
    EUR 158

    Anti-Rt CD8b FITC

    1F-656-C025 0.025 mg
    EUR 113

    Anti-Rt CD8b FITC

    1F-656-C100 0.1 mg
    EUR 186

    Anti-Rt CD8b PE

    1P-656-C025 0.025 mg
    EUR 122

    Anti-Rt CD8b PE

    1P-656-C100 0.1 mg
    EUR 204

    Anti-Ms CD8b PE

    1P-779-C025 0.025 mg
    EUR 122

    Anti-Ms CD8b PE

    1P-779-C100 0.1 mg
    EUR 204

    CD8B protein (His tag)

    80R-3653 100 ug
    EUR 327
    Description: Purified recombinant CD8B protein (His tag)

    Mouse Cd8b ELISA KIT

    ELI-24836m 96 Tests
    EUR 865

    Human CD8B ELISA KIT

    ELI-25164h 96 Tests
    EUR 824

    CD8B ELISA KIT|Human

    EF008529 96 Tests
    EUR 689

    Rat CD8B shRNA Plasmid

    20-abx984715
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Mouse CD8B shRNA Plasmid

    20-abx969589
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human CD8B shRNA Plasmid

    20-abx950654
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    CD8B Human Recombinant Protein

    PROTP10966 Regular: 20ug
    EUR 317
    Description: CD8B Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 172 amino acids (22-170) and having a molecular mass of 19.2 kDa. CD8B is fused to a 23 amino acid His-tag at N-terminus.

    CD8B Recombinant Protein (Human)

    RP037924 100 ug Ask for price

    CD8B Recombinant Protein (Rat)

    RP194051 100 ug Ask for price

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), APC

    4-PAQ127Hu01-APC
    • EUR 367.00
    • EUR 3581.00
    • EUR 989.00
    • EUR 470.00
    • EUR 228.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Pro170)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), Biotinylated

    4-PAQ127Hu01-Biotin
    • EUR 327.00
    • EUR 2684.00
    • EUR 783.00
    • EUR 403.00
    • EUR 225.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Pro170)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Biotin.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), Cy3

    4-PAQ127Hu01-Cy3
    • EUR 447.00
    • EUR 4733.00
    • EUR 1277.00
    • EUR 585.00
    • EUR 263.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Pro170)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with Cy3.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), FITC

    4-PAQ127Hu01-FITC
    • EUR 313.00
    • EUR 2884.00
    • EUR 811.00
    • EUR 396.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Pro170)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with FITC.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), HRP

    4-PAQ127Hu01-HRP
    • EUR 334.00
    • EUR 3120.00
    • EUR 873.00
    • EUR 424.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Pro170)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with HRP.

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), PE

    4-PAQ127Hu01-PE
    • EUR 313.00
    • EUR 2884.00
    • EUR 811.00
    • EUR 396.00
    • EUR 202.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Pro170)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with PE.

    Cluster of Differentiation 8b (CD8b) Antibody (FITC)

    20-abx270387
    • EUR 592.00
    • EUR 704.00
    • EUR 328.00
    • EUR 1107.00
    • EUR 439.00
    • 100 tests
    • 200 tests
    • 25 tests
    • 500 tests
    • 50 tests
    • Shipped within 5-15 working days.

    Cluster of Differentiation 8b (CD8b) Antibody (APC)

    20-abx270619
    • EUR 815.00
    • EUR 968.00
    • EUR 411.00
    • EUR 1567.00
    • EUR 565.00
    • 100 tests
    • 200 tests
    • 25 tests
    • 500 tests
    • 50 tests
    • Shipped within 5-15 working days.

    Cluster of Differentiation 8b (CD8b) Antibody (PE)

    20-abx270851
    • EUR 704.00
    • EUR 829.00
    • EUR 370.00
    • EUR 1330.00
    • EUR 495.00
    • 100 tests
    • 200 tests
    • 25 tests
    • 500 tests
    • 50 tests
    • Shipped within 5-15 working days.

    Human CellExp? CD8b, Human Recombinant

    P1244-10
    EUR 240

    Human CellExp? CD8b, Human Recombinant

    P1244-1000 Ask for price

    Human CellExp? CD8b, Human Recombinant

    P1244-250 Ask for price

    Human CellExp? CD8b, Human Recombinant

    P1244-50
    EUR 805

    Cd8b ORF Vector (Rat) (pORF)

    ORF064685 1.0 ug DNA
    EUR 506

    CD8B ORF Vector (Human) (pORF)

    ORF012642 1.0 ug DNA
    EUR 354

    CD8B ELISA Kit (Human) (OKCD00721)

    OKCD00721 96 Wells
    EUR 909
    Description: Description of target: Identifies cytotoxic/suppressor T-cells that interact with MHC class I bearing targets. CD8 is thought to play a role in the process of T-cell mediated killing. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.58 ng/mL

    Cluster Of Differentiation 8b (CD8b) Polyclonal Antibody (Human, Mouse, Rat), APC-Cy7

    4-PAQ127Hu01-APC-Cy7
    • EUR 614.00
    • EUR 7042.00
    • EUR 1858.00
    • EUR 821.00
    • EUR 337.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: CD8b (Leu22~Pro170)
    • Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    Description: A Rabbit polyclonal antibody against Human, Mouse, Rat Cluster Of Differentiation 8b (CD8b). This antibody is labeled with APC-Cy7.

    Rat Monoclonal Anti-Mouse CD8b (Ly 3), APC (Clone CT-CD8b) (rat IgG2a)

    MCD008B-APC 50 tests
    EUR 408

    Rat Monoclonal Anti-Mouse CD8b (Ly 3) , Biotin (Clone CT-CD8b) (rat IgG2a)

    MCD008B-B 100 tests
    EUR 469

    Rat Monoclonal Anti-Mouse CD8b (Ly 3), FITC (Clone CT-CD8b) (rat IgG2a)

    MCD008B-F 100 tests
    EUR 469

    Rat Monoclonal Anti-Mouse CD8b (Ly 3), Purified (Clone CT-CD8b) (rat IgG2a)

    MCD008B-M 100 ug
    EUR 482

    Rat Monoclonal Anti-Mouse CD8b (Ly 3), PE (Clone CT-CD8b) (rat IgG2a)

    MCD008B-PE 100 tests
    EUR 469

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNUB0190-100 100uL
    EUR 209
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), Concentration: 0.2mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNUB0190-500 500uL
    EUR 458
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), Concentration: 0.2mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNUM0190-50 50uL
    EUR 395
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), 1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC040190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF405S conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC040190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF405S conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC610190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF660R conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC610190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF660R conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC470190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF647 conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC470190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF647 conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC550190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF555 conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC550190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF555 conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC050190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF405M conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC050190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF405M conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC400190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF640R conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC400190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF640R conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC430190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF543 conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC430190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF543 conjugate, Concentration: 0.1mg/mL

    Cluster Of Differentiation 8a/8b (CD8A/CD8B) Antibody

    abx412983-01mg 0.1 mg
    EUR 509
    • Shipped within 1 week.

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC800190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF680 conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC800190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF680 conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC810190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF680R conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNC810190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), CF680R conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNCP0190-250 250uL
    EUR 383
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), PerCP conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNCR0190-250 250uL
    EUR 383
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), RPE conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNCA0190-250 250uL
    EUR 383
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), APC conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNCAP0190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNCAP0190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), Alkaline Phosphatase conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNCH0190-100 100uL
    EUR 199
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    CD8B (Cytotoxic / Suppressor T-Cell Marker) (BU88) Antibody

    BNCH0190-500 500uL
    EUR 544
    Description: Primary antibody against CD8B (Cytotoxic / Suppressor T-Cell Marker) ( BU88), Horseradish Peroxidase conjugate, Concentration: 0.1mg/mL

    CD8B Rabbit Polyclonal Antibody