P2RX2 Rabbit Polyclonal Antibody

P2RX2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    P2RX2 Rabbit pAb
    A7078-100ul 100 ul
    EUR 308
    P2RX2 Rabbit pAb
    A7078-200ul 200 ul
    EUR 459
    P2RX2 Rabbit pAb
    A7078-20ul 20 ul
    EUR 183
    P2RX2 Rabbit pAb
    A7078-50ul 50 ul
    EUR 223
    P2RX2 antibody
    70R-1518 100 ug
    EUR 377
    Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
    P2RX2 antibody
    70R-1520 100 ug
    EUR 377
    Description: Rabbit polyclonal P2RX2 antibody raised against the middle region of P2RX2
    P2RX2 Antibody
    37788-100ul 100ul
    EUR 252
    P2RX2 Antibody
    1-CSB-PA211403
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against P2RX2. Recognizes P2RX2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200
    P2RX2 Antibody
    1-CSB-PA244468
    • EUR 317.00
    • EUR 244.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
    Description: A polyclonal antibody against P2RX2. Recognizes P2RX2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000
    P2RX2 antibody
    70R-5054 50 ug
    EUR 467
    Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
    P2RX2 antibody
    70R-5081 50 ug
    EUR 467
    Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
    P2RX2 antibody
    70R-5086 50 ug
    EUR 467
    Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
    P2rx2 antibody
    70R-8075 50 ug
    EUR 467
    Description: Affinity purified rabbit polyclonal P2rx2 antibody
    P2RX2 antibody
    70R-5125 50 ug
    EUR 467
    Description: Rabbit polyclonal P2RX2 antibody raised against the middle region of P2RX2
    P2RX2 antibody
    70R-5145 50 ug
    EUR 467
    Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
    P2RX2 antibody
    70R-5166 50 ug
    EUR 467
    Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
    P2RX2 antibody
    70R-5171 50 ug
    EUR 467
    Description: Rabbit polyclonal P2RX2 antibody raised against the N terminal of P2RX2
    Polyclonal P2RX2 Antibody (N-term)
    APR08898G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human P2RX2 (N-term). This antibody is tested and proven to work in the following applications:
    P2rx2/ Rat P2rx2 ELISA Kit
    ELI-35724r 96 Tests
    EUR 886
    P2RX2 Conjugated Antibody
    C37788 100ul
    EUR 397
    Anti-P2RX2 antibody
    STJ13100214 100 µl
    EUR 427
    Anti-P2RX2 antibody
    STJ13100229 100 µl
    EUR 427
    Anti-P2RX2 antibody
    STJ29158 100 µl
    EUR 277
    Description: The product of this gene belongs to the family of purinoceptors for ATP. This receptor functions as a ligand-gated ion channel. Binding to ATP mediates synaptic transmission between neurons and from neurons to smooth muscle. Multiple transcript variants encoding distinct isoforms have been identified for this gene.
    Anti-P2RX2 antibody
    STJ192971 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to P2RX2
    P2RX2 siRNA
    20-abx903798
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    P2RX2 siRNA
    20-abx927526
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    P2RX2 siRNA
    20-abx927527
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    Anti-P2X2/P2RX2 Antibody
    PB9303 100ug/vial
    EUR 334
    P2RX2 Blocking Peptide
    33R-1942 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5086
    P2RX2 Blocking Peptide
    33R-1943 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5081
    P2RX2 Blocking Peptide
    33R-4132 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5125
    P2RX2 Blocking Peptide
    33R-5050 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-1520
    P2RX2 Blocking Peptide
    33R-5584 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5054
    P2RX2 Blocking Peptide
    33R-10100 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5166
    P2rx2 Blocking Peptide
    33R-10318 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2rx2 antibody, catalog no. 70R-8075
    P2RX2 Blocking Peptide
    33R-9779 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5145
    P2RX2 Blocking Peptide
    33R-9891 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-5171
    P2RX2 Blocking Peptide
    33R-7540 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of P2RX2 antibody, catalog no. 70R-1518
    P2RX2 cloning plasmid
    CSB-CL880063HU-10ug 10ug
    EUR 404
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1050
    • Sequence: ATGGCCGCCGCCCAGCCCAAGTACCCCGCCGGGGCGACCGCCCGGCGCCTGGCCCGGGGCTGCTGGTCCGCCCTCTGGGACTACGAGACGCCCAAGGTGATCGTGGTGAGGAACCGGCGCCTGGGGGTCCTGTACCGCGCCGTGCAGCTGCTCATCCTGCTCTACTTCGTGTGGT
    • Show more
    Description: A cloning plasmid for the P2RX2 gene.
    Rat P2RX2 shRNA Plasmid
    20-abx987169
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human P2RX2 shRNA Plasmid
    20-abx957896
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Mouse P2RX2 shRNA Plasmid
    20-abx981893
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    P2RX2 Recombinant Protein (Human)
    RP041980 100 ug Ask for price
    P2RX2 Recombinant Protein (Mouse)
    RP159746 100 ug Ask for price
    P2RX2 Recombinant Protein (Mouse)
    RP159749 100 ug Ask for price
    P2RX2 Recombinant Protein (Mouse)
    RP159752 100 ug Ask for price
    P2RX2 Recombinant Protein (Rat)
    RP219050 100 ug Ask for price
    Purinergic Receptor P2X 2 (P2RX2) Antibody
    20-abx006888
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Purinergic Receptor P2X 2 (P2RX2) Antibody
    20-abx213400
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    Purinergic Receptor P2X 2 (P2RX2) Antibody
    abx028529-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Purinergic Receptor P2X 2 (P2RX2) Antibody
    abx028529-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Purinergic Receptor P2X 2 (P2RX2) Antibody
    20-abx339683
    • EUR 411.00
    • EUR 300.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.
    P2rx2 ORF Vector (Rat) (pORF)
    ORF073018 1.0 ug DNA
    EUR 506
    P2RX2 ORF Vector (Human) (pORF)
    ORF013994 1.0 ug DNA
    EUR 354
    P2rx2 ORF Vector (Mouse) (pORF)
    ORF053250 1.0 ug DNA
    EUR 506
    P2rx2 ORF Vector (Mouse) (pORF)
    ORF053251 1.0 ug DNA
    EUR 506
    P2rx2 ORF Vector (Mouse) (pORF)
    ORF053252 1.0 ug DNA
    EUR 506
    P2rx2 sgRNA CRISPR Lentivector set (Rat)
    K7054701 3 x 1.0 ug
    EUR 339
    P2rx2 sgRNA CRISPR Lentivector set (Mouse)
    K4261301 3 x 1.0 ug
    EUR 339
    P2RX2 sgRNA CRISPR Lentivector set (Human)
    K1581301 3 x 1.0 ug
    EUR 339
    Human P2X purinoceptor 2, P2RX2 ELISA KIT
    ELI-12417h 96 Tests
    EUR 824
    P2rx2 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K7054702 1.0 ug DNA
    EUR 154
    P2rx2 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K7054703 1.0 ug DNA
    EUR 154
    P2rx2 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K7054704 1.0 ug DNA
    EUR 154
    P2rx2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
    K4261302 1.0 ug DNA
    EUR 154
    P2rx2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
    K4261303 1.0 ug DNA
    EUR 154
    P2rx2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
    K4261304 1.0 ug DNA
    EUR 154
    P2RX2 sgRNA CRISPR Lentivector (Human) (Target 1)
    K1581302 1.0 ug DNA
    EUR 154
    P2RX2 sgRNA CRISPR Lentivector (Human) (Target 2)
    K1581303 1.0 ug DNA
    EUR 154
    P2RX2 sgRNA CRISPR Lentivector (Human) (Target 3)
    K1581304 1.0 ug DNA
    EUR 154
    P2RX2 Protein Vector (Rat) (pPB-C-His)
    PV292070 500 ng
    EUR 603
    P2RX2 Protein Vector (Rat) (pPB-N-His)
    PV292071 500 ng
    EUR 603
    P2RX2 Protein Vector (Rat) (pPM-C-HA)
    PV292072 500 ng
    EUR 603
    P2RX2 Protein Vector (Rat) (pPM-C-His)
    PV292073 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPB-C-His)
    PV212998 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPB-N-His)
    PV212999 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPM-C-HA)
    PV213000 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPM-C-His)
    PV213001 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPB-C-His)
    PV213002 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPB-N-His)
    PV213003 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPM-C-HA)
    PV213004 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPM-C-His)
    PV213005 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPB-C-His)
    PV213006 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPB-N-His)
    PV213007 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPM-C-HA)
    PV213008 500 ng
    EUR 603
    P2RX2 Protein Vector (Mouse) (pPM-C-His)
    PV213009 500 ng
    EUR 603
    P2RX2 Protein Vector (Human) (pPB-C-His)
    PV055973 500 ng
    EUR 481
    P2RX2 Protein Vector (Human) (pPB-N-His)
    PV055974 500 ng
    EUR 481
    P2RX2 Protein Vector (Human) (pPM-C-HA)
    PV055975 500 ng
    EUR 481
    P2RX2 Protein Vector (Human) (pPM-C-His)
    PV055976 500 ng
    EUR 481
    P2rx2 3'UTR Luciferase Stable Cell Line
    TU115807 1.0 ml Ask for price
    P2rx2 3'UTR GFP Stable Cell Line
    TU165807 1.0 ml Ask for price
    P2rx2 3'UTR GFP Stable Cell Line
    TU265722 1.0 ml Ask for price
    P2rx2 3'UTR Luciferase Stable Cell Line
    TU215722 1.0 ml Ask for price
    P2RX2 3'UTR GFP Stable Cell Line
    TU067247 1.0 ml
    EUR 1394

    P2RX2 Rabbit Polyclonal Antibody