TAP1 Rabbit Polyclonal Antibody

TAP1 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    TAP1 Rabbit pAb

    A6213-100ul 100 ul
    EUR 308

    TAP1 Rabbit pAb

    A6213-200ul 200 ul
    EUR 459

    TAP1 Rabbit pAb

    A6213-20ul 20 ul
    EUR 183

    TAP1 Rabbit pAb

    A6213-50ul 50 ul
    EUR 223

    Human Antigen Peptide Transporter 1 (TAP1) ELISA Kit

    DLR-TAP1-Hu-48T 48T
    EUR 517
    • Should the Human Antigen Peptide Transporter 1 (TAP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Antigen Peptide Transporter 1 (TAP1) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Antigen Peptide Transporter 1 (TAP1) ELISA Kit

    DLR-TAP1-Hu-96T 96T
    EUR 673
    • Should the Human Antigen Peptide Transporter 1 (TAP1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
    Description: A sandwich quantitative ELISA assay kit for detection of Human Antigen Peptide Transporter 1 (TAP1) in samples from tissue homogenates, cell lysates or other biological fluids.

    Human Antigen Peptide Transporter 1 (TAP1) ELISA Kit

    RD-TAP1-Hu-48Tests 48 Tests
    EUR 521

    Human Antigen Peptide Transporter 1 (TAP1) ELISA Kit

    RD-TAP1-Hu-96Tests 96 Tests
    EUR 723

    Human Antigen Peptide Transporter 1 (TAP1) ELISA Kit

    RDR-TAP1-Hu-48Tests 48 Tests
    EUR 544

    Human Antigen Peptide Transporter 1 (TAP1) ELISA Kit

    RDR-TAP1-Hu-96Tests 96 Tests
    EUR 756

    TAP1 antibody

    70R-20704 50 ul
    EUR 435
    Description: Rabbit polyclonal TAP1 antibody

    TAP1 antibody

    38753-100ul 100ul
    EUR 252

    TAP1 antibody

    70R-5960 50 ug
    EUR 467
    Description: Rabbit polyclonal TAP1 antibody

    TAP1 Antibody

    1-CSB-PA023120ESR1HU
    • EUR 222.00
    • EUR 335.00
    • 100ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
    Description: A polyclonal antibody against TAP1. Recognizes TAP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

    TAP1 Antibody

    1-CSB-PA023120GA01HU
    • EUR 597.00
    • EUR 333.00
    • 150ul
    • 50ul
    • Form: Liquid
    • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
    Description: A polyclonal antibody against TAP1. Recognizes TAP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

    Polyclonal TAP1 Antibody (C-term)

    AMM08105G 0.1ml
    EUR 484
    Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TAP1 (C-term). This antibody is tested and proven to work in the following applications:

    Polyclonal TAP1 Antibody (internal region)

    AMM08106G 0.1 mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human TAP1 (internal region). This antibody is tested and proven to work in the following applications:

    Anti-TAP1 Antibody

    A01123 100ul
    EUR 397
    Description: Rabbit Polyclonal TAP1 Antibody. Validated in IP, IHC, WB and tested in Human, Rat.

    TAP1 Conjugated Antibody

    C38753 100ul
    EUR 397

    anti- TAP1 antibody

    FNab08499 100µg
    EUR 548.75
    • Immunogen: transporter 1, ATP-binding cassette, sub-family B(MDR/TAP)
    • Uniprot ID: Q03518
    • Gene ID: 6890
    • Research Area: Immunology
    Description: Antibody raised against TAP1

    Anti-TAP1 antibody

    PAab08499 100 ug
    EUR 386

    Anti-TAP1 Antibody

    PB9823 100ug/vial
    EUR 334

    Anti-TAP1 antibody

    STJ27969 100 µl
    EUR 277
    Description: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance. The protein encoded by this gene is involved in the pumping of degraded cytosolic peptides across the endoplasmic reticulum into the membrane-bound compartment where class I molecules assemble. Mutations in this gene may be associated with ankylosing spondylitis, insulin-dependent diabetes mellitus, and celiac disease. Two transcript variants encoding different isoforms have been found for this gene.

    Anti-TAP1 antibody

    STJ193130 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to TAP1

    Anti-TAP1 antibody

    STJ71702 100 µg
    EUR 359

    Tap1/ Rat Tap1 ELISA Kit

    ELI-13719r 96 Tests
    EUR 886

    TAP1 siRNA

    20-abx936027
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    TAP1 siRNA

    20-abx936028
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.

    Antigen Peptide Transporter 1 (TAP1) Polyclonal Antibody (Human)

    4-PAD113Hu01
    • EUR 247.00
    • EUR 2510.00
    • EUR 625.00
    • EUR 310.00
    • EUR 214.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TAP1 (Tyr525~Glu808)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Antigen Peptide Transporter 1 (TAP1)

    TAP1 Blocking Peptide

    33R-5544 100 ug
    EUR 180
    Description: A synthetic peptide for use as a blocking control in assays to test for specificity of TAP1 antibody, catalog no. 70R-5960

    TAP1 cloning plasmid

    CSB-CL023120HU-10ug 10ug
    EUR 789
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 2427
    • Sequence: atggctgagcttctcgccagcgcaggatcagcctgttcctgggactttccgagagccccgccctcgttccctcccccagccgccagtaggggaggactcggcggtacccggagcttcaggccccaccggggcgcggagagtcccaggcccggccgggaccgggacggcgtccgag
    • Show more
    Description: A cloning plasmid for the TAP1 gene.

    Anti-TAP1 (2B4)

    YF-MA15720 100 ug
    EUR 363
    Description: Mouse monoclonal to TAP1

    Anti-TAP1 (1B11)

    YF-MA15721 100 ug
    EUR 363
    Description: Mouse monoclonal to TAP1

    Anti-TAP1 (3D10)

    YF-MA15722 100 ug
    EUR 363
    Description: Mouse monoclonal to TAP1

    Anti-TAP1 (3D4)

    YF-MA15723 100 ug
    EUR 363
    Description: Mouse monoclonal to TAP1

    Antigen Peptide Transporter 1 (TAP1) Polyclonal Antibody (Human), APC

    4-PAD113Hu01-APC
    • EUR 345.00
    • EUR 3275.00
    • EUR 912.00
    • EUR 440.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TAP1 (Tyr525~Glu808)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Antigen Peptide Transporter 1 (TAP1). This antibody is labeled with APC.

    Antigen Peptide Transporter 1 (TAP1) Polyclonal Antibody (Human), Biotinylated

    4-PAD113Hu01-Biotin
    • EUR 311.00
    • EUR 2460.00
    • EUR 727.00
    • EUR 381.00
    • EUR 219.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TAP1 (Tyr525~Glu808)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Antigen Peptide Transporter 1 (TAP1). This antibody is labeled with Biotin.

    Antigen Peptide Transporter 1 (TAP1) Polyclonal Antibody (Human), Cy3

    4-PAD113Hu01-Cy3
    • EUR 419.00
    • EUR 4325.00
    • EUR 1175.00
    • EUR 545.00
    • EUR 251.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TAP1 (Tyr525~Glu808)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Antigen Peptide Transporter 1 (TAP1). This antibody is labeled with Cy3.

    Antigen Peptide Transporter 1 (TAP1) Polyclonal Antibody (Human), FITC

    4-PAD113Hu01-FITC
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TAP1 (Tyr525~Glu808)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Antigen Peptide Transporter 1 (TAP1). This antibody is labeled with FITC.

    Antigen Peptide Transporter 1 (TAP1) Polyclonal Antibody (Human), HRP

    4-PAD113Hu01-HRP
    • EUR 316.00
    • EUR 2855.00
    • EUR 807.00
    • EUR 398.00
    • EUR 206.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TAP1 (Tyr525~Glu808)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Antigen Peptide Transporter 1 (TAP1). This antibody is labeled with HRP.

    Antigen Peptide Transporter 1 (TAP1) Polyclonal Antibody (Human), PE

    4-PAD113Hu01-PE
    • EUR 296.00
    • EUR 2640.00
    • EUR 750.00
    • EUR 372.00
    • EUR 195.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TAP1 (Tyr525~Glu808)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Antigen Peptide Transporter 1 (TAP1). This antibody is labeled with PE.

    Rabbit Antigen peptide transporter 1(TAP1) ELISA kit

    E04A2004-192T 192 tests
    EUR 1270
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Antigen peptide transporter 1(TAP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Antigen peptide transporter 1(TAP1) ELISA kit

    E04A2004-48 1 plate of 48 wells
    EUR 520
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Antigen peptide transporter 1(TAP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Rabbit Antigen peptide transporter 1(TAP1) ELISA kit

    E04A2004-96 1 plate of 96 wells
    EUR 685
    • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
    • Show more
    Description: A competitive ELISA for quantitative measurement of Rabbit Antigen peptide transporter 1(TAP1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    abx025108-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    abx025108-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    20-abx004748
    • EUR 411.00
    • EUR 592.00
    • EUR 182.00
    • EUR 314.00
    • 100 ul
    • 200 ul
    • 20 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    20-abx116251
    • EUR 732.00
    • EUR 398.00
    • 150 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    20-abx130661
    • EUR 425.00
    • EUR 133.00
    • EUR 1205.00
    • EUR 578.00
    • EUR 328.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    20-abx171259
    • EUR 857.00
    • EUR 439.00
    • 1 mg
    • 200 ug
    • Please enquire.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    abx238499-100ug 100 ug
    EUR 509
    • Shipped within 5-12 working days.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    20-abx320264
    • EUR 300.00
    • EUR 244.00
    • 100 ul
    • 50 ul
    • Shipped within 5-10 working days.

    Antigen Peptide Transporter 1 (TAP1) Antibody

    abx433342-200ul 200 ul
    EUR 384
    • Shipped within 1-3 working days.

    Antigen Peptide Transporter 1 (TAP1) Polyclonal Antibody (Human), APC-Cy7

    4-PAD113Hu01-APC-Cy7
    • EUR 571.00
    • EUR 6430.00
    • EUR 1705.00
    • EUR 760.00
    • EUR 319.00
    • 100ul
    • 10ml
    • 1ml
    • 200ul
    • 20ul
    • Sequence of the immunogen: TAP1 (Tyr525~Glu808)
    • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
    Description: A Rabbit polyclonal antibody against Human Antigen Peptide Transporter 1 (TAP1). This antibody is labeled with APC-Cy7.

    TAP1 ELISA KIT|Human

    EF003451 96 Tests
    EUR 689

    Mouse TAP1 shRNA Plasmid

    20-abx972992
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    Human TAP1 shRNA Plasmid

    20-abx954718
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.

    TAP1 Recombinant Protein (Rat)

    RP232250 100 ug Ask for price

    TAP1 Recombinant Protein (Human)

    RP030913 100 ug Ask for price

    TAP1 Recombinant Protein (Mouse)

    RP177212 100 ug Ask for price

    TAP1 Recombinant Protein (Mouse)

    RP177215 100 ug Ask for price

    Tap1 ORF Vector (Rat) (pORF)

    ORF077418 1.0 ug DNA
    EUR 506

    TAP1 ORF Vector (Human) (pORF)

    ORF010305 1.0 ug DNA
    EUR 95

    Tap1 ORF Vector (Mouse) (pORF)

    ORF059072 1.0 ug DNA
    EUR 506

    Tap1 ORF Vector (Mouse) (pORF)

    ORF059073 1.0 ug DNA
    EUR 506

    pECMV-Tap1-m-FLAG Plasmid

    PVT15083 2 ug
    EUR 325

    TAP1 ELISA Kit (Human) (OKCD00893)

    OKCD00893 96 Wells
    EUR 831
    Description: Description of target: Involved in the transport of antigens from the cytoplasm to the endoplasmic reticulum for association with MHC class I molecules. Also acts as a molecular scaffold for the final stage of MHC class I folding, namely the binding of peptide. Nascent MHC class I molecules associate with TAP via tapasin. Inhibited by the covalent attachment of herpes simplex virus ICP47 protein, which blocks the peptide-binding site of TAP. Inhibited by human cytomegalovirus US6 glycoprotein, which binds to the lumenal side of the TAP complex and inhibits peptide translocation by specifically blocking ATP-binding to TAP1 and prevents the conformational rearrangement of TAP induced by peptide binding. Inhibited by human adenovirus E3-19K glycoprotein, which binds the TAP complex and acts as a tapasin inhibitor, preventing MHC class I/TAP association. Expression of TAP1 is down-regulated by human Epstein-Barr virus vIL-10 protein, thereby affecting the transport of peptides into the endoplasmic reticulum and subsequent peptide loading by MHC class I molecules. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.134 ng/mL

    Tap1 sgRNA CRISPR Lentivector set (Rat)

    K7612301 3 x 1.0 ug
    EUR 339

    Tap1 sgRNA CRISPR Lentivector set (Mouse)

    K4405901 3 x 1.0 ug
    EUR 339

    TAP1 sgRNA CRISPR Lentivector set (Human)

    K2331601 3 x 1.0 ug
    EUR 339

    Recombinant Antigen Peptide Transporter 1 (TAP1)

    4-RPD113Hu01
    • EUR 467.36
    • EUR 228.00
    • EUR 1477.60
    • EUR 559.20
    • EUR 1018.40
    • EUR 376.00
    • EUR 3544.00
    • 100 ug
    • 10ug
    • 1 mg
    • 200 ug
    • 500 ug
    • 50ug
    • 5 mg
    • Uniprot ID: Q03518
    • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
    • Form: Freeze-dried powder
    • Predicted Molecular Mass (KD): 34.6kDa
    • Isoelectric Point: Inquire
    Description: Recombinant Human Antigen Peptide Transporter 1 expressed in: E.coli

    ATP-binding cassette sub-family B (MDR/TAP) transporter 1 (TAP1) polyclonal antibody

    ABP-PAB-11138 100 ug Ask for price
      • Product line: Cell Surface Molecules / GPCRs
      • Brand:

    Human Antigen Peptide Transporter 1 (TAP1) Peptide

    20-abx650298
    • EUR 648.00
    • EUR 272.00
    • EUR 1998.00
    • EUR 773.00
    • EUR 467.00
    • 100 ug
    • 10 ug
    • 1 mg
    • 200 ug
    • 50 ug
    • Shipped within 5-7 working days.

    Tap1 sgRNA CRISPR Lentivector (Rat) (Target 1)

    K7612302 1.0 ug DNA
    EUR 154

    Tap1 sgRNA CRISPR Lentivector (Rat) (Target 2)

    K7612303 1.0 ug DNA
    EUR 154

    Tap1 sgRNA CRISPR Lentivector (Rat) (Target 3)

    K7612304 1.0 ug DNA
    EUR 154

    Tap1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

    K4405902 1.0 ug DNA
    EUR 154

    Tap1 sgRNA CRISPR Lentivector (Mouse) (Target 2)

    K4405903 1.0 ug DNA
    EUR 154

    Tap1 sgRNA CRISPR Lentivector (Mouse) (Target 3)

    K4405904 1.0 ug DNA
    EUR 154

    TAP1 sgRNA CRISPR Lentivector (Human) (Target 1)

    K2331602 1.0 ug DNA
    EUR 154

    TAP1 sgRNA CRISPR Lentivector (Human) (Target 2)

    K2331603 1.0 ug DNA
    EUR 154

    TAP1 sgRNA CRISPR Lentivector (Human) (Target 3)

    K2331604 1.0 ug DNA
    EUR 154

    TAP1 Protein Vector (Rat) (pPB-C-His)

    PV309670 500 ng
    EUR 1166

    TAP1 Protein Vector (Rat) (pPB-N-His)

    PV309671 500 ng
    EUR 1166

    TAP1 Protein Vector (Rat) (pPM-C-HA)

    PV309672 500 ng
    EUR 1166

    TAP1 Protein Vector (Rat) (pPM-C-His)

    PV309673 500 ng
    EUR 1166

    TAP1 Protein Vector (Human) (pPB-C-His)

    PV041217 500 ng
    EUR 329

    TAP1 Protein Vector (Human) (pPB-N-His)

    PV041218 500 ng
    EUR 329

    TAP1 Protein Vector (Human) (pPM-C-HA)

    PV041219 500 ng
    EUR 329

    TAP1 Protein Vector (Human) (pPM-C-His)

    PV041220 500 ng
    EUR 329

    TAP1 Protein Vector (Mouse) (pPB-C-His)

    PV236286 500 ng
    EUR 1065

    TAP1 Protein Vector (Mouse) (pPB-N-His)

    PV236287 500 ng
    EUR 1065

    TAP1 Protein Vector (Mouse) (pPM-C-HA)

    PV236288 500 ng
    EUR 1065

    TAP1 Protein Vector (Mouse) (pPM-C-His)

    PV236289 500 ng
    EUR 1065

    TAP1 Protein Vector (Mouse) (pPB-C-His)

    PV236290 500 ng
    EUR 1065

    TAP1 Protein Vector (Mouse) (pPB-N-His)

    PV236291 500 ng
    EUR 1065

    TAP1 Protein Vector (Mouse) (pPM-C-HA)

    PV236292 500 ng
    EUR 1065

    TAP1 Protein Vector (Mouse) (pPM-C-His)

    PV236293 500 ng
    EUR 1065

    Tap1 3'UTR Luciferase Stable Cell Line

    TU120130 1.0 ml Ask for price

    Tap1 3'UTR GFP Stable Cell Line

    TU170130 1.0 ml Ask for price

    Tap1 3'UTR Luciferase Stable Cell Line

    TU221571 1.0 ml Ask for price

    TAP1 3'UTR GFP Stable Cell Line

    TU075122 1.0 ml
    EUR 1394

    Tap1 3'UTR GFP Stable Cell Line

    TU271571 1.0 ml Ask for price

    TAP1 3'UTR Luciferase Stable Cell Line

    TU025122 1.0 ml
    EUR 1394

    GAPDH Rabbit Polyclonal Antibody

    37985-100ul 100ul
    EUR 252

    GAPDH Rabbit Polyclonal Antibody

    37985-50ul 50ul
    EUR 187

    EFHD1 Rabbit Polyclonal Antibody

    38001-100ul 100ul
    EUR 252

    EFHD1 Rabbit Polyclonal Antibody

    38001-50ul 50ul
    EUR 187

    Alliinase Rabbit Polyclonal Antibody

    38042-100ul 100ul
    EUR 252

    Alliinase Rabbit Polyclonal Antibody

    38042-50ul 50ul
    EUR 187

    ECFP Rabbit Polyclonal Antibody

    38077-100ul 100ul
    EUR 252

    ECFP Rabbit Polyclonal Antibody

    38077-50ul 50ul
    EUR 187

    EYFP Rabbit Polyclonal Antibody

    38078-100ul 100ul
    EUR 252

    EYFP Rabbit Polyclonal Antibody

    38078-50ul 50ul
    EUR 187

    mOrange Rabbit Polyclonal Antibody

    38079-100ul 100ul
    EUR 252

    mOrange Rabbit Polyclonal Antibody

    38079-50ul 50ul
    EUR 187

    mStrawberry Rabbit Polyclonal Antibody

    38083-100ul 100ul
    EUR 252

    mStrawberry Rabbit Polyclonal Antibody

    38083-50ul 50ul
    EUR 187

    AmCyan Rabbit Polyclonal Antibody

    38086-100ul 100ul
    EUR 252

    AmCyan Rabbit Polyclonal Antibody

    38086-50ul 50ul
    EUR 187

    EBFP Rabbit Polyclonal Antibody

    38087-100ul 100ul
    EUR 252

    EBFP Rabbit Polyclonal Antibody

    38087-50ul 50ul
    EUR 187

    Vimentin Rabbit Polyclonal Antibody

    38104-100ul 100ul
    EUR 252

    Vimentin Rabbit Polyclonal Antibody

    38104-50ul 50ul
    EUR 187

    LDHD Rabbit Polyclonal Antibody

    38105-100ul 100ul
    EUR 252

    LDHD Rabbit Polyclonal Antibody

    38105-50ul 50ul
    EUR 187

    GAPDH Rabbit Polyclonal Antibody

    A01021-005ml 0.05ml
    EUR 147
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml 0.2ml
    EUR 332
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    GAPDH Rabbit Polyclonal Antibody

    A01021-02ml5 0.2ml×5
    EUR 920
    • Immunogen information: Recombinant Protein
    • Applications tips: Suggested starting dilutions are as follows: WB (1:5000), IHC-P (1:200). Please, note that that to ensure best results sometimes the optimal dilutions for the applications need to be adju
    • Show more
    Description: A polyclonal antibody for detection of GAPDH from Human, Mouse, Rat, Rabbit, Chicken, Monkey, Sheep, Xneous. This GAPDH antibody is for WB, IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein

    Rabbit Hemoglobin Polyclonal Antibody

    A53073 100 µg
    EUR 570.55
    Description: The best epigenetics products

    Met Rabbit Polyclonal Antibody

    ABP57458-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    Met Rabbit Polyclonal Antibody

    ABP57458-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Met of MET
    • Applications tips:
    Description: A polyclonal antibody for detection of Met from Human, Mouse, Rat. This Met antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Met of MET

    VEGF Rabbit Polyclonal Antibody

    ABP57460-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    VEGF Rabbit Polyclonal Antibody

    ABP57460-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of VEGF of VEGFA
    • Applications tips:
    Description: A polyclonal antibody for detection of VEGF from Human, Mouse, Rat. This VEGF antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of VEGF of VEGFA

    CD10 Rabbit Polyclonal Antibody

    ABP57461-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    CD10 Rabbit Polyclonal Antibody

    ABP57461-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of CD10 of MME
    • Applications tips:
    Description: A polyclonal antibody for detection of CD10 from Human, Mouse, Rat. This CD10 antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of CD10 of MME

    NM23A Rabbit Polyclonal Antibody

    ABP57462-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    NM23A Rabbit Polyclonal Antibody

    ABP57462-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NM23A of NME1
    • Applications tips:
    Description: A polyclonal antibody for detection of NM23A from Human, Mouse, Rat. This NM23A antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NM23A of NME1

    ATM Rabbit Polyclonal Antibody

    ABP57463-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57463-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    ATM Rabbit Polyclonal Antibody

    ABP57464-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATM of ATM
    • Applications tips:
    Description: A polyclonal antibody for detection of ATM from Human, Mouse, Rat. This ATM antibody is for IHC-P. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATM of ATM

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSC70 Rabbit Polyclonal Antibody

    ABP57565-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)
    • Applications tips:
    Description: A polyclonal antibody for detection of HSC70 from Human, Mouse, Rat. This HSC70 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Heat shock cognate 71 kDa protein (Heat shock 70 kDa protein 8)

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP40 Rabbit Polyclonal Antibody

    ABP57566-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP40
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP40 from Human, Mouse, Rat. This HSP40 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP40

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    HSP90Alpha Rabbit Polyclonal Antibody

    ABP57567-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of HSP90?
    • Applications tips:
    Description: A polyclonal antibody for detection of HSP90Alpha from Human, Mouse, Rat. This HSP90Alpha antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of HSP90?

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK1 Rabbit Polyclonal Antibody

    ABP57569-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK1
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK1 from Human, Mouse, Rat. This JAK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK1

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JAK2 Rabbit Polyclonal Antibody

    ABP57570-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JAK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JAK2 from Human, Mouse, Rat. This JAK2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JAK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK2 Rabbit Polyclonal Antibody

    ABP57571-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK2
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK2 from Human, Mouse, Rat. This JNK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK2

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    JNK3 Rabbit Polyclonal Antibody

    ABP57572-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of JNK3
    • Applications tips:
    Description: A polyclonal antibody for detection of JNK3 from Human, Mouse, Rat. This JNK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of JNK3

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK2 Rabbit Polyclonal Antibody

    ABP57573-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK2
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK2 from Human. This MEK2 antibody is for WB, IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK2

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    MEK3 Rabbit Polyclonal Antibody

    ABP57574-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of MEK3
    • Applications tips:
    Description: A polyclonal antibody for detection of MEK3 from Human, Mouse, Rat. This MEK3 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of MEK3

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    Nrf2 Rabbit Polyclonal Antibody

    ABP57575-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Nrf2
    • Applications tips:
    Description: A polyclonal antibody for detection of Nrf2 from Human, Mouse, Rat. This Nrf2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Nrf2

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4a Rabbit Polyclonal Antibody

    ABP57576-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4a
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4a from Human, Mouse, Rat. This ATG4a antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4a

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4b Rabbit Polyclonal Antibody

    ABP57577-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4b
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4b from Human, Mouse, Rat. This ATG4b antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4b

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG4c Rabbit Polyclonal Antibody

    ABP57578-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG4c
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG4c from Human, Mouse, Rat. This ATG4c antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG4c

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG5 Rabbit Polyclonal Antibody

    ABP57579-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG5
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG5 from Human, Mouse, Rat. This ATG5 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG5

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG7 Rabbit Polyclonal Antibody

    ABP57580-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG7
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG7 from Human, Mouse, Rat. This ATG7 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG7

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57581-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG13 Rabbit Polyclonal Antibody

    ABP57582-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG13
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG13 from Human, Mouse, Rat. This ATG13 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG13

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    ATG14L Rabbit Polyclonal Antibody

    ABP57583-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ATG14L
    • Applications tips:
    Description: A polyclonal antibody for detection of ATG14L from Human, Mouse, Rat. This ATG14L antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ATG14L

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57585-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    NBR1 Rabbit Polyclonal Antibody

    ABP57586-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of NBR1
    • Applications tips:
    Description: A polyclonal antibody for detection of NBR1 from Human, Mouse, Rat. This NBR1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of NBR1

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    WIPI2 Rabbit Polyclonal Antibody

    ABP57587-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of WIPI2
    • Applications tips:
    Description: A polyclonal antibody for detection of WIPI2 from Human, Mouse, Rat. This WIPI2 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of WIPI2

    FAK Rabbit Polyclonal Antibody

    ABP57588-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    FAK Rabbit Polyclonal Antibody

    ABP57588-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    FAK Rabbit Polyclonal Antibody

    ABP57588-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of FAK
    • Applications tips:
    Description: A polyclonal antibody for detection of FAK from Human, Mouse, Rat. This FAK antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of FAK

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    Gab1 Rabbit Polyclonal Antibody

    ABP57589-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of Gab1
    • Applications tips:
    Description: A polyclonal antibody for detection of Gab1 from Human, Mouse, Rat. This Gab1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of Gab1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-003ml 0.03ml
    EUR 158
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-01ml 0.1ml
    EUR 289
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    ERK1 Rabbit Polyclonal Antibody

    ABP57590-02ml 0.2ml
    EUR 414
    • Immunogen information: Recombinant Protein of ERK1
    • Applications tips:
    Description: A polyclonal antibody for detection of ERK1 from Human, Mouse, Rat. This ERK1 antibody is for IHC-P. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen recombinant protein of ERK1

    VEGF Rabbit Polyclonal Antibody

    ES8453-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    VEGF Rabbit Polyclonal Antibody

    ES8453-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against VEGF Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    CD10 Rabbit Polyclonal Antibody

    ES8454-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against CD10 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NM23A Rabbit Polyclonal Antibody

    ES8455-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NM23A Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8456-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATM Rabbit Polyclonal Antibody

    ES8457-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATM Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSC70 Rabbit Polyclonal Antibody

    ES8558-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSC70 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP40 Rabbit Polyclonal Antibody

    ES8559-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP40 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    HSP90? Rabbit Polyclonal Antibody

    ES8560-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against HSP90? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    IkB ? Rabbit Polyclonal Antibody

    ES8561-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against IkB ? Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK1 Rabbit Polyclonal Antibody

    ES8562-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JAK2 Rabbit Polyclonal Antibody

    ES8563-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JAK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK2 Rabbit Polyclonal Antibody

    ES8564-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    JNK3 Rabbit Polyclonal Antibody

    ES8565-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against JNK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK2 Rabbit Polyclonal Antibody

    ES8566-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK2 Rabbit from Human. This antibody is tested and validated for WB, ELISA, IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    MEK3 Rabbit Polyclonal Antibody

    ES8567-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against MEK3 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    Nrf2 Rabbit Polyclonal Antibody

    ES8568-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against Nrf2 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4a Rabbit Polyclonal Antibody

    ES8569-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4a Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4b Rabbit Polyclonal Antibody

    ES8570-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4b Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG4c Rabbit Polyclonal Antibody

    ES8571-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG4c Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG5 Rabbit Polyclonal Antibody

    ES8572-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG5 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG7 Rabbit Polyclonal Antibody

    ES8573-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG7 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8574-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG13 Rabbit Polyclonal Antibody

    ES8575-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG13 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    ATG14L Rabbit Polyclonal Antibody

    ES8576-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against ATG14L Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8578-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    NBR1 Rabbit Polyclonal Antibody

    ES8579-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against NBR1 Rabbit from Human/Mouse/Rat. This antibody is tested and validated for IHC

    TAP1 Rabbit Polyclonal Antibody