GPER Rabbit Polyclonal Antibody

GPER Rabbit Polyclonal Antibody

Contact Us Below To Order :

Polyclonal GPER Antibody (C-term)
APR07130G	Leading Biology	0.1ml	EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER (C-term). This antibody is tested and proven to work in the following applications:

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
DLR-GPER-Hu-48T	DL Develop	48T	EUR 517
Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
DLR-GPER-Hu-96T	DL Develop	96T	EUR 673
Should the Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
DLR-GPER-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
DLR-GPER-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse G Protein Coupled Estrogen Receptor 1 (GPER) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RDR-GPER-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse G Protein Coupled Estrogen Receptor 1 (GPER) ELISA Kit
RD-GPER-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Gper/ Rat Gper ELISA Kit
ELI-03937r	Lifescience Market	96 Tests	EUR 886

Polyclonal GPER antibody - C-terminal region
AMRa00042G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human GPER - C-terminal region. This antibody is tested and proven to work in the following applications:

Anti-GPER antibody
STJ192629	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to GPER

GPER cloning plasmid
CSB-CL859933HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1128 Sequence: atggatgtgacttcccaagcccggggcgtgggcctggagatgtacctaggcaccgcgcagcctgcggcccccaacaccacctcccccgagctcaacctgtcccacccgctcctgggcaccgccctggccaatgggacaggtgagctctcggagcaccagcagtacgtgatcggcc Show more
Description: A cloning plasmid for the GPER gene.

GPER ELISA KIT|Human
EF004242	Lifescience Market	96 Tests	EUR 689

GPER Recombinant Protein (Human)
RP013738	ABM	100 ug	Ask for price

GPER Recombinant Protein (Rat)
RP203225	ABM	100 ug	Ask for price

Gper ORF Vector (Rat) (pORF)
ORF067743	ABM	1.0 ug DNA	EUR 506

GPER ORF Vector (Human) (pORF)
ORF004580	ABM	1.0 ug DNA	EUR 95

GPER ELISA Kit (Human) (OKCD08888)
OKCD08888	Aviva Systems Biology	96 Wells	EUR 975
Description: Description of target: This gene is a member of the G-protein coupled receptor 1 family and encodes a multi-pass membrane protein that localizes to the endoplasmic reticulum. The protein binds estrogen, resulting in intracellular calcium mobilization and synthesis of phosphatidylinositol 3,4,5-trisphosphate in the nucleus. This protein therefore plays a role in the rapid nongenomic signaling events widely observed following stimulation of cells and tissues with estrogen. Alternate transcriptional splice variants which encode the same protein have been characterized.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.125ng/mL

G Protein Coupled Estrogen Receptor 1 (GPER) Antibody
20-abx176524	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

G Protein Coupled Estrogen Receptor 1 (GPER) Antibody
20-abx176525	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

G Protein Coupled Estrogen Receptor 1 (GPER) Antibody
20-abx176526	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

G Protein Coupled Estrogen Receptor 1 (GPER) Antibody
20-abx172491	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Gper sgRNA CRISPR Lentivector set (Rat)
K7043101	ABM	3 x 1.0 ug	EUR 339

GPER sgRNA CRISPR Lentivector set (Human)
K0887401	ABM	3 x 1.0 ug	EUR 339

Gper sgRNA CRISPR Lentivector (Rat) (Target 1)
K7043102	ABM	1.0 ug DNA	EUR 154

Gper sgRNA CRISPR Lentivector (Rat) (Target 2)
K7043103	ABM	1.0 ug DNA	EUR 154

Gper sgRNA CRISPR Lentivector (Rat) (Target 3)
K7043104	ABM	1.0 ug DNA	EUR 154

GPER sgRNA CRISPR Lentivector (Human) (Target 1)
K0887402	ABM	1.0 ug DNA	EUR 154

GPER sgRNA CRISPR Lentivector (Human) (Target 2)
K0887403	ABM	1.0 ug DNA	EUR 154

GPER Rabbit Polyclonal Antibody