PCGF2 Rabbit Polyclonal Antibody

PCGF2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

PCGF2 Polyclonal Antibody
ABP59846-01ml	Abbkine	0.1ml	EUR 289
Immunogen information: Synthesized peptide derived from part region of human PCGF2 protein Applications tips:
Description: A polyclonal antibody for detection of PCGF2 from Human, Mouse. This PCGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCGF2 protein

PCGF2 Polyclonal Antibody
ABP59846-02ml	Abbkine	0.2ml	EUR 414
Immunogen information: Synthesized peptide derived from part region of human PCGF2 protein Applications tips:
Description: A polyclonal antibody for detection of PCGF2 from Human, Mouse. This PCGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCGF2 protein

PCGF2 Polyclonal Antibody
ES11974-100ul	ELK Biotech	100ul	EUR 279
Description: A Rabbit Polyclonal antibody against PCGF2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PCGF2 Polyclonal Antibody
ES11974-50ul	ELK Biotech	50ul	EUR 207
Description: A Rabbit Polyclonal antibody against PCGF2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA

PCGF2 Polyclonal Conjugated Antibody
C30018	SAB	100ul	EUR 397

PCGF2 Rabbit pAb
A17327-100ul	Abclonal	100 ul	EUR 308

PCGF2 Rabbit pAb
A17327-200ul	Abclonal	200 ul	EUR 459

PCGF2 Rabbit pAb
A17327-20ul	Abclonal	20 ul	EUR 183

PCGF2 Rabbit pAb
A17327-50ul	Abclonal	50 ul	EUR 223

PCGF2 Antibody
1-CSB-PA017606LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCGF2. Recognizes PCGF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

Polyclonal Goat Anti-MEL18 / PCGF2 Antibody
APG00198G	Leading Biology	0.1mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MEL18 / PCGF2 . This antibody is tested and proven to work in the following applications:

PCGF2 Antibody (HRP)
20-abx317080	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PCGF2 Antibody (FITC)
20-abx317081	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

PCGF2 Antibody (Biotin)
20-abx317082	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-PCGF2 antibody
STJ119456	St John's Laboratory	100 µl	EUR 277
Description: The protein encoded by this gene contains a RING finger motif and is similar to the polycomb group (PcG) gene products. PcG gene products form complexes via protein-protein interaction and maintain the transcription repression of genes involved in embryogenesis, cell cycles, and tumorigenesis. This protein was shown to act as a negative regulator of transcription and has tumor suppressor activity. The expression of this gene was detected in various tumor cells, but is limited in neural organs in normal tissues. Knockout studies in mice suggested that this protein may negatively regulate the expression of different cytokines, chemokines, and chemokine receptors, and thus plays an important role in lymphocyte differentiation and migration, as well as in immune responses.

Anti-PCGF2 antibody
STJ193132	St John's Laboratory	200 µl	EUR 197
Description: Unconjugated Rabbit polyclonal to PCGF2

PCGF2 siRNA
20-abx927943	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PCGF2 siRNA
20-abx927944	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

PCGF2 Antibody, HRP conjugated
1-CSB-PA017606LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCGF2. Recognizes PCGF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

PCGF2 Antibody, FITC conjugated
1-CSB-PA017606LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCGF2. Recognizes PCGF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

PCGF2 Antibody, Biotin conjugated
1-CSB-PA017606LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against PCGF2. Recognizes PCGF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Anti-MEL18 / PCGF2 antibody
STJ70369	St John's Laboratory	100 µg	EUR 359

PCGF2 cloning plasmid
CSB-CL017606HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1035 Sequence: atgcatcggactacacggatcaaaatcacagagctgaacccccacctcatgtgtgccctctgcggggggtacttcatcgacgccaccactatcgtggagtgcctgcattccttctgcaaaacctgcatcgtgcgctacctggagaccaacaaatactgccccatgtgtgacgtgc Show more
Description: A cloning plasmid for the PCGF2 gene.

pOTB7-pcgf2 Plasmid
PVTB00139	Lifescience Market	2 ug	EUR 356

Mouse PCGF2 shRNA Plasmid
20-abx973445	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human PCGF2 shRNA Plasmid
20-abx955221	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

PCGF2 Recombinant Protein (Human)
RP022726	ABM	100 ug	Ask for price

PCGF2 Recombinant Protein (Mouse)
RP160652	ABM	100 ug	Ask for price

PCGF2 Recombinant Protein (Mouse)
RP160655	ABM	100 ug	Ask for price

PCGF2 Recombinant Protein (Mouse)
RP160658	ABM	100 ug	Ask for price

PCGF2 Recombinant Protein (Rat)
RP219602	ABM	100 ug	Ask for price

Monoclonal PCGF2 Antibody (monoclonal) (M04), Clone: 4C10
AMM03895G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human PCGF2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4C10. This antibody is applicable in WB

Monoclonal PCGF2 Antibody (monoclonal) (M05), Clone: 2D6
AMM03896G	Leading Biology	0.1mg	EUR 484
Description: A Monoclonal antibody against Human PCGF2 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 2D6. This antibody is applicable in WB

Pcgf2 ORF Vector (Rat) (pORF)
ORF073202	ABM	1.0 ug DNA	EUR 506

PCGF2 ORF Vector (Human) (pORF)
ORF007576	ABM	1.0 ug DNA	EUR 95

Pcgf2 ORF Vector (Mouse) (pORF)
ORF053552	ABM	1.0 ug DNA	EUR 506

Pcgf2 ORF Vector (Mouse) (pORF)
ORF053553	ABM	1.0 ug DNA	EUR 506

Pcgf2 ORF Vector (Mouse) (pORF)
ORF053554	ABM	1.0 ug DNA	EUR 506

Polycomb Group RING Finger Protein 2 (PCGF2) Antibody
abx028410-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Polycomb Group RING Finger Protein 2 (PCGF2) Antibody
abx028410-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Polycomb Group RING Finger Protein 2 (PCGF2) Antibody
20-abx317079	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Pcgf2 sgRNA CRISPR Lentivector set (Rat)
K6617201	ABM	3 x 1.0 ug	EUR 339

Pcgf2 sgRNA CRISPR Lentivector set (Mouse)
K3899401	ABM	3 x 1.0 ug	EUR 339

PCGF2 sgRNA CRISPR Lentivector set (Human)
K1610201	ABM	3 x 1.0 ug	EUR 339

Pcgf2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6617202	ABM	1.0 ug DNA	EUR 154

Pcgf2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6617203	ABM	1.0 ug DNA	EUR 154

Pcgf2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6617204	ABM	1.0 ug DNA	EUR 154

PCGF2 Rabbit Polyclonal Antibody