PCGF2 Rabbit Polyclonal Antibody

PCGF2 Rabbit Polyclonal Antibody

Contact Us Below To Order :

    PCGF2 Polyclonal Antibody
    ABP59846-01ml 0.1ml
    EUR 289
    • Immunogen information: Synthesized peptide derived from part region of human PCGF2 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PCGF2 from Human, Mouse. This PCGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCGF2 protein
    PCGF2 Polyclonal Antibody
    ABP59846-02ml 0.2ml
    EUR 414
    • Immunogen information: Synthesized peptide derived from part region of human PCGF2 protein
    • Applications tips:
    Description: A polyclonal antibody for detection of PCGF2 from Human, Mouse. This PCGF2 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human PCGF2 protein
    PCGF2 Polyclonal Antibody
    ES11974-100ul 100ul
    EUR 279
    Description: A Rabbit Polyclonal antibody against PCGF2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    PCGF2 Polyclonal Antibody
    ES11974-50ul 50ul
    EUR 207
    Description: A Rabbit Polyclonal antibody against PCGF2 from Human/Mouse. This antibody is tested and validated for WB, ELISA, WB, ELISA
    PCGF2 Polyclonal Conjugated Antibody
    C30018 100ul
    EUR 397
    PCGF2 Rabbit pAb
    A17327-100ul 100 ul
    EUR 308
    PCGF2 Rabbit pAb
    A17327-200ul 200 ul
    EUR 459
    PCGF2 Rabbit pAb
    A17327-20ul 20 ul
    EUR 183
    PCGF2 Rabbit pAb
    A17327-50ul 50 ul
    EUR 223
    PCGF2 Antibody
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PCGF2. Recognizes PCGF2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200
    Polyclonal Goat Anti-MEL18 / PCGF2 Antibody
    APG00198G 0.1mg
    EUR 484
    Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Goat Anti-MEL18 / PCGF2 . This antibody is tested and proven to work in the following applications:
    PCGF2 Antibody (HRP)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    PCGF2 Antibody (FITC)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    PCGF2 Antibody (Biotin)
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Anti-PCGF2 antibody
    STJ119456 100 µl
    EUR 277
    Description: The protein encoded by this gene contains a RING finger motif and is similar to the polycomb group (PcG) gene products. PcG gene products form complexes via protein-protein interaction and maintain the transcription repression of genes involved in embryogenesis, cell cycles, and tumorigenesis. This protein was shown to act as a negative regulator of transcription and has tumor suppressor activity. The expression of this gene was detected in various tumor cells, but is limited in neural organs in normal tissues. Knockout studies in mice suggested that this protein may negatively regulate the expression of different cytokines, chemokines, and chemokine receptors, and thus plays an important role in lymphocyte differentiation and migration, as well as in immune responses.
    Anti-PCGF2 antibody
    STJ193132 200 µl
    EUR 197
    Description: Unconjugated Rabbit polyclonal to PCGF2
    PCGF2 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PCGF2 siRNA
    • EUR 551.00
    • EUR 732.00
    • 15 nmol
    • 30 nmol
    • Shipped within 5-10 working days.
    PCGF2 Antibody, HRP conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PCGF2. Recognizes PCGF2 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA
    PCGF2 Antibody, FITC conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PCGF2. Recognizes PCGF2 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA
    PCGF2 Antibody, Biotin conjugated
    • EUR 317.00
    • EUR 335.00
    • 100ug
    • 50ug
    • Form: Liquid
    • Buffer: Preservative: 0.03% Proclin 300
      Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
    Description: A polyclonal antibody against PCGF2. Recognizes PCGF2 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA
    Anti-MEL18 / PCGF2 antibody
    STJ70369 100 µg
    EUR 359
    PCGF2 cloning plasmid
    CSB-CL017606HU-10ug 10ug
    EUR 233
    • Formulation: 10 μg plasmid + 200μl Glycerol
    • Length: 1035
    • Sequence: atgcatcggactacacggatcaaaatcacagagctgaacccccacctcatgtgtgccctctgcggggggtacttcatcgacgccaccactatcgtggagtgcctgcattccttctgcaaaacctgcatcgtgcgctacctggagaccaacaaatactgccccatgtgtgacgtgc
    • Show more
    Description: A cloning plasmid for the PCGF2 gene.
    pOTB7-pcgf2 Plasmid
    PVTB00139 2 ug
    EUR 356
    Mouse PCGF2 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    Human PCGF2 shRNA Plasmid
    • EUR 801.00
    • EUR 1121.00
    • 150 µg
    • 300 µg
    • Shipped within 15-20 working days.
    PCGF2 Recombinant Protein (Human)
    RP022726 100 ug Ask for price
    PCGF2 Recombinant Protein (Mouse)
    RP160652 100 ug Ask for price
    PCGF2 Recombinant Protein (Mouse)
    RP160655 100 ug Ask for price
    PCGF2 Recombinant Protein (Mouse)
    RP160658 100 ug Ask for price
    PCGF2 Recombinant Protein (Rat)
    RP219602 100 ug Ask for price
    Monoclonal PCGF2 Antibody (monoclonal) (M04), Clone: 4C10
    AMM03895G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human PCGF2 (monoclonal) (M04). The antibodies are raised in mouse and are from clone 4C10. This antibody is applicable in WB
    Monoclonal PCGF2 Antibody (monoclonal) (M05), Clone: 2D6
    AMM03896G 0.1mg
    EUR 484
    Description: A Monoclonal antibody against Human PCGF2 (monoclonal) (M05). The antibodies are raised in mouse and are from clone 2D6. This antibody is applicable in WB
    Pcgf2 ORF Vector (Rat) (pORF)
    ORF073202 1.0 ug DNA
    EUR 506
    PCGF2 ORF Vector (Human) (pORF)
    ORF007576 1.0 ug DNA
    EUR 95
    Pcgf2 ORF Vector (Mouse) (pORF)
    ORF053552 1.0 ug DNA
    EUR 506
    Pcgf2 ORF Vector (Mouse) (pORF)
    ORF053553 1.0 ug DNA
    EUR 506
    Pcgf2 ORF Vector (Mouse) (pORF)
    ORF053554 1.0 ug DNA
    EUR 506
    Polycomb Group RING Finger Protein 2 (PCGF2) Antibody
    abx028410-400ul 400 ul
    EUR 523
    • Shipped within 5-10 working days.
    Polycomb Group RING Finger Protein 2 (PCGF2) Antibody
    abx028410-80l 80 µl
    EUR 286
    • Shipped within 5-10 working days.
    Polycomb Group RING Finger Protein 2 (PCGF2) Antibody
    • EUR 411.00
    • EUR 1845.00
    • EUR 599.00
    • EUR 182.00
    • EUR 300.00
    • 100 ug
    • 1 mg
    • 200 ug
    • 20 ug
    • 50 ug
    • Shipped within 5-10 working days.
    Pcgf2 sgRNA CRISPR Lentivector set (Rat)
    K6617201 3 x 1.0 ug
    EUR 339
    Pcgf2 sgRNA CRISPR Lentivector set (Mouse)
    K3899401 3 x 1.0 ug
    EUR 339
    PCGF2 sgRNA CRISPR Lentivector set (Human)
    K1610201 3 x 1.0 ug
    EUR 339
    Pcgf2 sgRNA CRISPR Lentivector (Rat) (Target 1)
    K6617202 1.0 ug DNA
    EUR 154
    Pcgf2 sgRNA CRISPR Lentivector (Rat) (Target 2)
    K6617203 1.0 ug DNA
    EUR 154
    Pcgf2 sgRNA CRISPR Lentivector (Rat) (Target 3)
    K6617204 1.0 ug DNA
    EUR 154

    PCGF2 Rabbit Polyclonal Antibody